Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
MotifExpress
useful
0
Loading...
MotifExpress = function(containerId, options) { new Application.motifExpress(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } Application.motifExpress = function() { this._init.apply(this, arguments); }; Application.motifExpress.prototype = { _default : { applicationMaxOption : "max", applicationMinOption : "min" }, _init : function(containerId, options) { var applicationOption = options.applicationOption; if (this._default.applicationMaxOption === applicationOption) { new Application.motifMax(containerId, options); } else if (this._default.applicationMinOption === applicationOption) { new Application.motifMin(containerId, options); } else { throw "Please select a valid application."; } }, }; Application.motifMax = function() { this._init.apply(this, arguments); }; Application.motifMax.prototype = { _containerId : null, _baseSequence : null, _options : null, _tooltip : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, //_motifConflict : null, _motifViewDialogId : null, _addAnotherMotifDialogId : null, _motifConflictConfirmDialogId : null, _geneInfoContainerId : null, _motifView : null, _default : { appName : "MotifExpress: Max", selectPropertyCaption : "Select Property", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", databaseInfoClass : "databaseInfo", addAnotherMotifButtonClass : "addAnotherMotifButton", geneLabelClass : "geneUrl", dbInfoLinkClass : "dbInfoLink", geneInfoLinkClass : "geneInfoLink", geneInfoAttedLinkClass : "geneInfoAttedLink", geneInfoPpdbLinkClass : "geneInfoPpdbLink", geneInfoEfpLinkClass : "geneInfoEfpLink", geneInfoHannaDbLinkClass : "geneInfoHannaDbLink", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", conflictionDialogTitle : "Confliction", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", geneTypeAtted : "ATTED", geneTypePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png", callback : function() {}, loadingImageContainer : "loadingImageContainer", loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif", loadingMessageClass : "loadingMessage", loadingMessage : "Loading linked data, it may take a few minutes...", serverUrl : "http://linkdata.org/", }, _tag : { topResult : "result_top", bottomResult : "result_bottom" }, _tooltipName : { selectProperty : "selectproperty", atted2 : "atted-ii", hanaDb : "hanadb", efp : "efp", ppdb : "ppdb", replace : "replace", manuallyInputMotif : "userinputmotif", motifExpress : "motifexpress", motifCircatian : "motifcircadian" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; //this._motifConflict = new Application.MotifConflication(this._containerId); //this._motifConflict._setHtmlSetFunction(this._doReplaceWithHtml); //this._motifConflict._setHtmlSetFunctionOwner(this); var date = new Date(); this._geneInfoContainerId = "gene_info_containerId_" + date.getTime(); this._initToolTip(); this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initMotifView(this._options); this._initHeptamer(); this._initOctamer(); this._initView(); this._initDialog(); }, _initToolTip : function() { var self = this; self._tooltip = (self._options.tooltip) ? self._options.tooltip : new Application.tooltip(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initMotifView : function(opts) { var self = this; var obj = { baseSequenceMinLength : opts.baseSequenceMinLength, baseSequence : opts.baseSequence, replaceSequenceClass : opts.replaceSequenceClass, callerObj : self, geneLabelClass : opts.geneLabelClass } this._motifView = new Application.MotifView(this._containerId,obj); }, _initAppSequence : function(opts) { var self = this; var timer = new Application.timer(); var init = function() { var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); if (seqProperty && posProperty) { var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : self._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : self._containerId, errorMessageClass : self._options.errorMessageAreaClass, baseSequenceMinLength : self._options.baseSequenceMinLength }; self._appSequence = new Application.sequence(obj); //self._motifConflict._setAppSequnce(self._appSequence); } else { timer.call(init); } } init(); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); //this._initDialogView(); this._initAddAnotherMotifDialogView(); this._initConflictConfirmDialogView(); }, _initDialog : function() { //this._initMotifViewDialog(); this._initAddAnotherMotifDialog(); //this._initMotifConflictConfirmDialog(); this._initMotifConflictConfirmDialog(); }, _initMainView : function() { var self = this; var timer = new Application.timer(); var fillOptionMethod = function() { var optionArray = self._motifProperty.getOptionArray(); if (optionArray) { var sb = []; sb[sb.length] = "<div class='" + self._options.selectPropertyAreaClass + " row'>"; sb[sb.length] = "<div class='label left'>" + self._options.selectPropertyCaption + "</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + self._options.selectPropertyClass + "' title='" + self._tooltip.getByKey(self._tooltipName.selectProperty) + "'>"; sb[sb.length] = "<option value='" + -1 + "'>-- Select Property --</option>"; $.each(optionArray, function(key, obj) { sb[sb.length] = "<option value='" + obj.key + "' title='" + self._tooltip.getByKey(obj.value) + "'>" + obj.value + "</option>"; }); sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div id='" + self._geneInfoContainerId + "'></div>"; sb[sb.length] = "<div class='" + self._options.resultAreaClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.errorMessageAreaClass + " hidden'>error</div>"; sb[sb.length] = "<div class='" + self._options.replaceButtonAreaClass + " hidden'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.replace) + "' class='" + self._options.replaceButtonClass + " btn btn-lightblue'>Add Motifs</a> "; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.manuallyInputMotif) + "' class='" + self._options.addAnotherMotifButtonClass + " btn btn-lightblue'>Manually Input Motif</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.replaceSequenceClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>"; sb[sb.length] = "<div class='" + self._options.loadingMessageClass + "'>" + self._options.loadingMessage + "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + self._containerId).html(sb.join("")); self._initListener(); } else { timer.call(fillOptionMethod); } } fillOptionMethod(); }, /* _initDialogView : function() { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; //sb[sb.length] = "<div class='motifImageArea'>"; //sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; //sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Click "; //sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); },*/ /* getMotifViewHtml : function(sequnce) { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<fieldset class='motifViewDialog'>"; sb[sb.length] = "<legend>Motif view: edit the position and copy number of a motif</legend>"; sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden "+ sequnce +"'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; //sb[sb.length] = "<div class='motifImageArea'>"; //sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; //sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Click "; //sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<a id='motifview_placeMotif' class='btn btn-lightblue'>Place Motif</a>"; sb[sb.length] = " "; sb[sb.length] = "<a id='motifview_cancel' class='btn btn-lightblue'>Cancel</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<fieldset class='motifviewinfo'>"; sb[sb.length] = "<span class='motifsequence' /></br>"; sb[sb.length] = "<span class='motifmethod' /></br>"; sb[sb.length] = "<span class='motifrecpos' />"; sb[sb.length] = "</fieldset>"; sb[sb.length] = "</fieldset>"; sb[sb.length] = "</div>"; return sb.join(""); },*/ _initAddAnotherMotifDialogView : function() { var sb = [], self = this, date = new Date(); this._addAnotherMotifDialogId = "addAnotherMotifDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._addAnotherMotifDialogId + "' class='hidden'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Motif Sequence</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherSequence'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Position(-550 to -50)</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherPosition'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initConflictConfirmDialogView : function() { var sb = [], self = this, date = new Date(); self._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + self._motifConflictConfirmDialogId + "' class='hidden'>"; sb[sb.length] = "<div>New motif overlaps with old one. Which one should be kept in overalp regions?</div>"; sb[sb.length] = "<div class='option'>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='new'/> New</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='old'/> Old</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='discard'/> Discard new motif</label></div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<label><input type='checkbox' checked=checked class='motifReplaceApplyToAllMotifMax' value='applytoall'/> Apply to all</label>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initListener : function() { var self = this; self._initSelectPropertyListener(); self._initAddAnotherMotifButtonListener(); }, _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var setSelectListener = function() { if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length != 0) { $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { $("#" + self._containerId + " ." + self._options.loadingImageContainer).show(); self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); $("#" + self._containerId + " #" + self._geneInfoContainerId).hide(); var propLabel = $("option:selected", this).val(); self._showMotifMaxSequence(workId, fileName, propLabel); }); } else { timer.call(setSelectListener); } } setSelectListener(); }, _initAddAnotherMotifButtonListener : function() { var self = this; $("#" + self._containerId + " ." + self._options.addAnotherMotifButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._addAnotherMotifDialogId + " .anotherSequence").val(""); $("#" + self._addAnotherMotifDialogId + " .anotherPosition").val(""); $("#" + self._addAnotherMotifDialogId).dialog("open"); }); }, _showGenePlot : function(subject, property) { var self = this; $("#" + self._containerId + " #" + self._geneInfoContainerId).show(); var options = { workId : self._options.workId, fileName : self._options.fileName, subject : subject, property : property }; new Application.geneChart(self._geneInfoContainerId, options); }, _showDataBaseInformationList : function() { var self = this, seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { var tmpPos = $(this).siblings(".hdnCorPosition").val(); seqVal.push($(this).val() + "[" + tmpPos + "]"); }); self._showDatabaseInfo(seqVal.join(", ")); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).unbind("click"); $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { var seqs = [], nonConflictSeqs = [], seqArray = [], posArray = [], conflictArray = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); var seq = $(this).find(".hdnSequence").val(); var pos = $(this).find(".hdnPosition").val(); seqArray.push(seq); posArray.push(pos); if (self._hasConfliction(seq, pos)) { conflictArray.push(seq + "|" + pos); } else { nonConflictSeqs.push($(this).text()); } }); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); if (conflictArray.length > 0) { self._doReplace(nonConflictSeqs, seqArray, posArray); self._handleConfliction(conflictArray); } else { self._doReplace(seqs, seqArray, posArray); } }); }, /* _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { //$("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); var pos = $(parent).find(".hdnPosition").val(); var seqEl = self._getSeqElBySeq(seq); var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; if (self.isMotifViewExists(seq) == false) { self.drawMotifView(seq,appropriatePos); self._initSequencePopup(seqEl); $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide(); $("#" + self._motifViewDialogId + " .sequence").val(seq); $("#" + self._motifViewDialogId + " .position").val("-" + appropriatePos); $("#" + self._motifViewDialogId + " .extraCopies").val(0); $("#" + self._motifViewDialogId + " .basePairs").val(0); $("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq)); $("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $("#" + self._motifViewDialogId).show(); } //$("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); //$("#" + self._motifViewDialogId).dialog("open"); //$("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); },*/ /* _initSequencePopup : function(seqEl) { var self = this; $("#" + self._motifViewDialogId + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; $("#" + self._motifViewDialogId + " .moreInfo").click(function() { self._showPopupWindow(url); }); },*/ _hasConfliction : function(seq, pos, oldSequence) { var self = this; if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var array = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(array); for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); if (nChar !== "-" && oChar !== "-" && nChar !== oChar) { return true; } } return false; }, _handleConfliction : function(conflictArray) { var self = this; if (conflictArray.length > 0) { var arr = conflictArray[0].split("|"); var bArray = self._getConflictConfirmDialogButtonArray(conflictArray); var dialogTitle = self._options.conflictionDialogTitle + " - " + arr[0] + "[" + arr[1] + "]"; $("#" + self._motifConflictConfirmDialogId).find("input[name='motifReplaceOption'][value='new']").attr("checked", "checked"); var checkBox = $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMax']"); $(checkBox).attr("checked",$(checkBox).is(':checked')); //$("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); $("#" + self._motifConflictConfirmDialogId).dialog({title : dialogTitle}); $("#" + self._motifConflictConfirmDialogId).dialog({buttons : bArray}); $("#" + self._motifConflictConfirmDialogId).dialog("open"); } else { $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMax']").attr("checked", "checked"); } }, _replaceWithOption : function(option, isApplyToAll, conflictArray) { var self = this; if (isApplyToAll) { self._replaceAllWithOption(option, conflictArray); $("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); } else { var value = conflictArray.splice(0, 1); var arr = value[0].split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); self._handleConfliction(conflictArray); } }, _replaceAllWithOption : function(option, conflictArray) { var self = this, html = oldSequence; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } $.each(conflictArray, function(key, conflict) { var arr = conflict.split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); }); }, _replaceSequenceByOption : function(option, seq, pos) { var self = this; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var seqArray = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(seqArray); var html = oldSequence; if (option === "new") { html = self._appSequence.getHtmlByReplacingNewSequence(oldSequence, newSequence); } else if (option === "old") { html = self._appSequence.getHtmlByReplacingOldSequence(oldSequence, newSequence); } self._doReplaceWithHtml(html); }, _getConflictConfirmDialogButtonArray : function(conflictArray) { var self = this; return [ { text: "Done", click : function() { $(this).dialog("close"); var option = $(this).find("input[name='motifReplaceOption']:checked").val(); var isApplyToAll = $(this).find(".motifReplaceApplyToAll").is(":checked"); self._replaceWithOption(option, isApplyToAll, conflictArray); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ]; }, _doReplace : function(seqs, seqArray, posArray) { var self = this; var html = self._appSequence.replace(seqs, seqArray, posArray); self._doReplaceWithHtml(html); }, _doReplaceWithHtml : function(html) { var self = this, sb = []; var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); self._showDataBaseInformationList(); self._options.callback(); }, _addAnotherMotif : function(seq, pos) { var self = this, conflictArray = []; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } if (self._hasConfliction(seq, pos, oldSequence)) { conflictArray.push(seq + "|" + pos); } if (conflictArray.length > 0) { self._handleConfliction(conflictArray); } else { self._replaceSequenceByOption("new", seq, pos); } }, _showPopupWindow : function(url) { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }, /* _initPositionInsert : function(seq, pos) { var self = this; var mod = seq.length % 2; $("#" + self._motifViewDialogId + " .position").unbind("keyup"); $("#" + self._motifViewDialogId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(Math.abs(val)); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); },*/ /* _initMotifViewDialog : function() { var self = this; $("#" + self._motifViewDialogId).dialog({ autoOpen: false, title: self._default.motifViewDialogTitle, width: 520, dialogClass : self._options.motifViewDialogClass, buttons : [ { text: "Replace", click : function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = Math.abs($("#" + self._motifViewDialogId).find(".position").val()); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._appSequence.hideError(); self._replaceWithSequence(seq, pos, extraCopies, basePairs); $(this).dialog("close"); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); },*/ /* isMotifViewExists : function(sequnce) { if ($("#" + this._motifViewDialogId + "."+ sequnce).length > 0) { return true; } else { return false; } },*/ /* drawMotifView : function(sequence,appropriatePos) { var self = this; var htmlContent = this.getMotifViewHtml(sequence); //$("#" + this._containerId).append(htmlContent); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).before(htmlContent); $("#" + self._motifViewDialogId).find(".motifsequence").html("Motif Sequence: " + sequence); $("#" + self._motifViewDialogId).find(".motifmethod").html("Motif Method: "); $("#" + self._motifViewDialogId).find(".motifrecpos").html("Motif Recommended Position: -" + appropriatePos); $("#" + self._motifViewDialogId).find("#motifview_placeMotif").click(function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = Math.abs($("#" + self._motifViewDialogId).find(".position").val()); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._appSequence.hideError(); self._replaceWithSequence(seq, pos, extraCopies, basePairs); //$(this).dialog("close"); }); $("#" + this._containerId).find("#motifview_cancel").click(function() { $("#" + self._motifViewDialogId).remove(); }); },*/ _initAddAnotherMotifDialog : function() { var self = this; $("#" + self._addAnotherMotifDialogId).dialog({ autoOpen: false, title: "Input Motif", buttons : [ { text: "Add", click : function() { var seq = $(this).find(".anotherSequence").val(); var pos = Math.abs($(this).find(".anotherPosition").val()); if (seq && pos) { self._addAnotherMotif(seq, pos); $(this).dialog("close"); } } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, _initMotifConflictConfirmDialog : function() { var self = this; $("#" + self._motifConflictConfirmDialogId).dialog({ autoOpen: false, width: 420, dialogClass : "motifConflictionDialog" }); }, _getMotifMaxTriple : function(workId, fileName, property) { var self = this; var index = new Application.index(1, 8000); var maxTriple; var getTriplesByProperty = function(tripleList) { var maxIndex = -1; var maxValue = -99999; $.each (tripleList, function(tKey, tValue) { var tmpValue = parseFloat(tValue.object); if (Math.max(tmpValue, maxValue) != maxValue) { maxValue = tmpValue; maxIndex = tKey; } }); if (maxIndex != -1) { if (!maxTriple) { maxTriple = tripleList[maxIndex]; } var tmpMaxValue = parseFloat(maxTriple.object); var currentValue = parseFloat(tripleList[maxIndex].object); if (Math.max(tmpMaxValue, currentValue) != tmpMaxValue) { maxTriple = tripleList[maxIndex]; } } if (tripleList && tripleList.length == index.getItemCount()) { LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.increment()); } else { self._motifMaxSequence(workId, fileName, maxTriple.subject, property); } } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.getIndex()); }, _showMotifMaxSequence : function(workId, fileName, propLabel) { var self = this, foundTopFile = false; var getFilesByTag = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { var tmpName = fName.split("_top"); if (fileName.indexOf(tmpName[0]) > -1) { self._getTopFilePropertyList(workId, fileName, wId, fName, propLabel); foundTopFile = true; return false; } }); }); if (!foundTopFile) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._getMotifMaxTriple(workId, fileName, property); } } LinkData.getFilesByTag(null, self._tag.topResult, getFilesByTag); }, _getTopFilePropertyList : function(workId, fileName, topWorkId, topFileName, propLabel) { var self = this; var getProperties = function(propList) { $.each(propList, function(propKey, propValue) { var tmpProperty = self._motifProperty._getLabel(propValue); if (tmpProperty.indexOf(propLabel) > -1) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._showMotifMax(workId, fileName, property, topWorkId, topFileName, propValue); return false; } }); } LinkData.getProperties(topWorkId, topFileName, getProperties); }, _showMotifMax : function(workId, fileName, property, topWorkId, topFileName, topProperty) { var self = this; var index = new Application.index(1, 1000); var getTriplesByProperty = function(tripleList) { self._showMotifMaxByTripleList(workId, fileName, property, tripleList); } LinkData.getTriplesByProperty(topWorkId, topFileName, topProperty, getTriplesByProperty, index.getIndex()); }, _showMotifMaxByTripleList : function(workId, fileName, property, tripleList) { var self = this, i = 0, subject = tripleList[i].object; var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); var showMaxMotif = function(posTripleList) { var found = false; i++; $.each(posTripleList, function(pKey, pValue) { var tmpPos = parseInt(pValue); if (self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos) { found = true; self._motifMaxSequence(workId, fileName, subject, property); return false; } }); if (! found) { subject = tripleList[i].object; LinkData.getObjects(workId, fileName, subject, posProperty, showMaxMotif); } } LinkData.getObjects(workId, fileName, subject, posProperty, showMaxMotif); }, _getDataBaseWebsiteName : function() { var self = this; var fileName = self._options.fileName; if (fileName.indexOf(self._options.websiteNameAtted) > -1) { return self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { return self._options.websiteNamePpdb; } else { return "UNKNOWN"; } }, _getGeneType : function() { var self = this, fileName = self._options.fileName; if (fileName.indexOf(self._options.geneTypeAtted) > -1) { return self._options.geneTypeAtted; } else if (fileName.indexOf(self._options.geneTypePpdb) > -1) { return self._options.geneTypePpdb; } else { return "UNKNOWN"; } }, _motifMaxSequence : function(workId, fileName, subject, property) { var self = this; var drawSequence = function(seqHtml) { var sb = []; sb[sb.length] = "<input type='hidden' class='" + self._default.geneLabelClass + "' value='" + subject + "'/>"; sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length == 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } self._motifView._initMotifSequenceListener(); self._initReplaceButtonLitener(); self._showDataBaseInformationList(); self._showGenePlot(subject, property); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.resultAreaClass).scrollLeft(10000); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); } self._appSequence.getSequenceHtml(subject, drawSequence); }, /* _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; },*/ /* _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; },*/ _getSeqElBySeq : function(seq) { if (seq && seq.trim().length == 7) { return this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length == 8) { return this._octamer.getBySequence(seq); } }, _showDatabaseInfo : function(seqVal) { var self = this, workId = self._options.workId, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var label = self._motifProperty._getDisplayLabel(propLabel); label = (label && label.trim().length != 0) ? label : propLabel; var usedMotif = (seqVal.length != 0) ? seqVal : "-"; var dbInfoHtml = self._getDatabaseInfo(workId, fileName, appName, subject, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); self._previewListener(subject); }, _previewListener : function(subject) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); self._dbPreviewListener(); self._genePreviewListener(subject); self._attedPreviewListener(subject); self._ppdbPreviewListener(gene); self._efpPreviewListener(gene); self._hannaDbPreviewListener(gene); }, _dbPreviewListener : function() { var self = this; var workId = self._options.workId, fileName = self._options.fileName; var url = self._options.serverUrl + "work/" + workId + "/" + fileName + ".html#work_information"; $("#" + self._containerId + " ." + self._options.dbInfoLinkClass).click(function() { self._showPopupWindow(url); }); }, _genePreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() { self._showPopupWindow(subject); }); }, _attedPreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoAttedLinkClass).click(function() { self._showPopupWindow(subject); }); }, _ppdbPreviewListener : function(gene) { var self = this; var url = "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoPpdbLinkClass).click(function() { self._showPopupWindow(url); }); }, _efpPreviewListener : function(gene) { var self = this; var url = "http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi?dataSource=Developmental_Map&modeInput=Absolute&primaryGene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoEfpLinkClass).click(function() { self._showPopupWindow(url); }); }, _hannaDbPreviewListener : function(gene) { var self = this; var url = "http://evolver.psc.riken.jp/seiken/GENE/" + gene.toUpperCase() + ".html"; $("#" + self._containerId + " ." + self._options.geneInfoHannaDbLinkClass).click(function() { self._showPopupWindow(url); }); }, _getDatabaseInfo : function(workId, fileName, method, subject, property, motif) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<span title='" + self._tooltip.getByKey(fileName) + "'>" + fileName + "</span>"; sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.dbInfoLinkClass + "'>LinkData</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Tool</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(self._tooltipName.motifExpress) + "'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Locus</div>"; sb[sb.length] = "<div class='left'>"; //sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.geneInfoLinkClass + "'>" + gene + "</a>"; sb[sb.length] = "<span>" + gene + "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Data and Visualization Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.atted2) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoAttedLinkClass + "'>ATTED-II</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.ppdb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoPpdbLinkClass + "'>PPDB</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.efp) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "'>eFP</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.hanaDb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoHannaDbLinkClass + "'>HanaDB</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Property</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(property) + "'>" + property + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif</div>"; sb[sb.length] = "<div class='left motif'>" + motif + "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, /* _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this, sb = []; //var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs); self._placeMotifViewSequnce(seq, pos, extraCopies, basePairs); var html = self._appSequence.getReColoredMotifViewSequnce(seq, pos, extraCopies, basePairs, self._options.replaceSequenceClass); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); var seqLabel = seq + "[" + pos + "]"; self._showDatabaseInfo(seqLabel); self._options.callback(); },*/ /* _placeMotifViewSequnce : function(seq, pos, extraCopies, basePairs) { var self =this,conflictArray = []; var corPos; //replaceSequenceByOption var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } for (var j = 0; j < extraCopies + 1; j++) { if (j == 0) { corPos = pos; } else { corPos = corPos + (basePairs) + (seq.length); } if (self._hasConfliction(seq, corPos, oldSequence)) { conflictArray.push(seq + "|" + corPos); } else { self._replaceSequenceByOption("new", seq, corPos); } self._handleConfliction(conflictArray); } //return out.join(""); }*/ }; Application.motifMin = function() { this._init.apply(this, arguments); }; Application.motifMin.prototype = { _containerId : null, _baseSequence : null, _options : null, _tooltip : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, _motifViewDialogId : null, _addAnotherMotifDialogId : null, _motifConflictConfirmDialogId : null, _geneInfoContainerId : null, _motifView : null, _default : { appName : "MotifExpress: Min", selectPropertyCaption : "Select Property", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", databaseInfoClass : "databaseInfo", addAnotherMotifButtonClass : "addAnotherMotifButton", geneLabelClass : "geneUrl", dbInfoLinkClass : "dbInfoLink", geneInfoLinkClass : "geneInfoLink", geneInfoAttedLinkClass : "geneInfoAttedLink", geneInfoPpdbLinkClass : "geneInfoPpdbLink", geneInfoEfpLinkClass : "geneInfoEfpLink", geneInfoHannaDbLinkClass : "geneInfoHannaDbLink", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", conflictionDialogTitle : "Confliction", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", geneTypeAtted : "ATTED", geneTypePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png", callback : function() {}, loadingImageContainer : "loadingImageContainer", loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif", loadingMessageClass : "loadingMessage", loadingMessage : "Loading linked data, it may take a few minutes...", serverUrl : "http://linkdata.org/" }, _tag : { topResult : "result_top", bottomResult : "result_bottom" }, _tooltipName : { selectProperty : "selectproperty", atted2 : "atted-ii", hanaDb : "hanadb", efp : "efp", ppdb : "ppdb", replace : "replace", manuallyInputMotif : "userinputmotif" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; var date = new Date(); this._geneInfoContainerId = "gene_info_containerId_" + date.getTime(); this._initToolTip(); this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initMotifView(this._options); this._initHeptamer(); this._initOctamer(); this._initView(); this._initDialog(); }, _initToolTip : function() { var self = this; self._tooltip = (self._options.tooltip) ? self._options.tooltip : new Application.tooltip(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initMotifView : function(opts) { var self = this; var obj = { baseSequenceMinLength : opts.baseSequenceMinLength, baseSequence : opts.baseSequence, replaceSequenceClass : opts.replaceSequenceClass, callerObj : self, geneLabelClass : opts.geneLabelClass } this._motifView = new Application.MotifView(this._containerId,obj); }, _initAppSequence : function(opts) { var self = this; var timer = new Application.timer(); var init = function() { var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); if (seqProperty && posProperty) { var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : self._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : self._containerId, errorMessageClass : self._options.errorMessageAreaClass, baseSequenceMinLength : self._options.baseSequenceMinLength }; self._appSequence = new Application.sequence(obj); } else { timer.call(init); } } init(); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); //this._initDialogView(); this._initAddAnotherMotifDialogView(); this._initConflictConfirmDialogView(); }, _initDialog : function() { //this._initMotifViewDialog(); this._initAddAnotherMotifDialog(); this._initMotifConflictConfirmDialog(); }, _initMainView : function() { var self = this; var timer = new Application.timer(); var fillOptionMethod = function() { var optionArray = self._motifProperty.getOptionArray(); if (optionArray) { var sb = []; sb[sb.length] = "<div class='" + self._options.selectPropertyAreaClass + " row'>"; sb[sb.length] = "<div class='label left'>" + self._options.selectPropertyCaption + "</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + self._options.selectPropertyClass + "' title='" + self._tooltip.getByKey(self._tooltipName.selectProperty) + "'>"; sb[sb.length] = "<option value='" + -1 + "'>-- Select Property --</option>"; $.each(optionArray, function(key, obj) { sb[sb.length] = "<option value='" + obj.key + "' title='" + self._tooltip.getByKey(obj.value) + "'>" + obj.value + "</option>"; }); sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div id='" + self._geneInfoContainerId + "'></div>"; sb[sb.length] = "<div class='" + self._options.resultAreaClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.errorMessageAreaClass + " hidden'>error</div>"; sb[sb.length] = "<div class='" + self._options.replaceButtonAreaClass + " hidden'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.replace) + "' class='" + self._options.replaceButtonClass + " btn btn-lightblue'>Add Motifs</a> "; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.manuallyInputMotif) + "' class='" + self._options.addAnotherMotifButtonClass + " btn btn-lightblue'>Manually Input Motif</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.replaceSequenceClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>"; sb[sb.length] = "<div class='" + self._options.loadingMessageClass + "'>" + self._options.loadingMessage + "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + self._containerId).html(sb.join("")); self._initListener(); } else { timer.call(fillOptionMethod); } } fillOptionMethod(); }, /* _initDialogView : function() { var sb = [], self = this, date = new Date(); this._motifViewDialogId = "motifViewDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._motifViewDialogId + "' class='hidden'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; //sb[sb.length] = "<div class='motifImageArea'>"; //sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; //sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Click "; //sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); },*/ _initAddAnotherMotifDialogView : function() { var sb = [], self = this, date = new Date(); this._addAnotherMotifDialogId = "addAnotherMotifDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._addAnotherMotifDialogId + "' class='hidden'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Motif Sequence</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherSequence'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Position(-550 to -50)</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherPosition'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initConflictConfirmDialogView : function() { var sb = [], self = this, date = new Date(); self._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + self._motifConflictConfirmDialogId + "' class='hidden'>"; sb[sb.length] = "<div>New motif overlaps with old one. Which one should be kept in overalp regions?</div>"; sb[sb.length] = "<div class='option'>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='new'/> New</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='old'/> Old</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='discard'/> Discard new motif</label></div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<label><input type='checkbox' checked='checked' class='motifReplaceApplyToAllMotifMin' value='applytoall'/> Apply to all</label>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initListener : function() { var self = this; self._initSelectPropertyListener(); self._initAddAnotherMotifButtonListener(); }, _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var setSelectListener = function() { if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length != 0) { $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { $("#" + self._containerId + " ." + self._options.loadingImageContainer).show(); self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); $("#" + self._containerId + " #" + self._geneInfoContainerId).hide(); var propLabel = $("option:selected", this).val(); self._showMotifMinSequence(workId, fileName, propLabel); }); } else { timer.call(setSelectListener); } } setSelectListener(); }, _initAddAnotherMotifButtonListener : function() { var self = this; $("#" + self._containerId + " ." + self._options.addAnotherMotifButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._addAnotherMotifDialogId + " .anotherSequence").val(""); $("#" + self._addAnotherMotifDialogId + " .anotherPosition").val(""); $("#" + self._addAnotherMotifDialogId).dialog("open"); }); }, _showGenePlot : function(subject, property) { var self = this; $("#" + self._containerId + " #" + self._geneInfoContainerId).show(); var options = { workId : self._options.workId, fileName : self._options.fileName, subject : subject, property : property }; new Application.geneChart(self._geneInfoContainerId, options); }, _showDataBaseInformationList : function() { var self = this, seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { var tmpPos = $(this).siblings(".hdnCorPosition").val(); seqVal.push($(this).val() + "[" + tmpPos + "]"); }); self._showDatabaseInfo(seqVal.join(", ")); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).unbind("click"); $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { var seqs = [], nonConflictSeqs = [], seqArray = [], posArray = [], conflictArray = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); var seq = $(this).find(".hdnSequence").val(); var pos = $(this).find(".hdnPosition").val(); seqArray.push(seq); posArray.push(pos); if (self._hasConfliction(seq, pos)) { conflictArray.push(seq + "|" + pos); } else { nonConflictSeqs.push($(this).text()); } }); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); if (conflictArray.length > 0) { self._doReplace(nonConflictSeqs, seqArray, posArray); self._handleConfliction(conflictArray); } else { self._doReplace(seqs, seqArray, posArray); } }); }, /* _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { $("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); var pos = $(parent).find(".hdnPosition").val(); var seqEl = self._getSeqElBySeq(seq); var appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; self._initSequencePopup(seqEl); $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass).hide(); $("#" + self._motifViewDialogId + " .sequence").val(seq); $("#" + self._motifViewDialogId + " .position").val("-" + appropriatePos); $("#" + self._motifViewDialogId + " .extraCopies").val(0); $("#" + self._motifViewDialogId + " .basePairs").val(0); $("#" + self._motifViewDialogId + " .minSeq").html(self._getMinPosition(seq)); $("#" + self._motifViewDialogId + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); $("#" + self._motifViewDialogId).dialog("open"); $("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); },*/ /* _initSequencePopup : function(seqEl) { var self = this; $("#" + self._motifViewDialogId + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; $("#" + self._motifViewDialogId + " .moreInfo").click(function() { self._showPopupWindow(url); }); },*/ _hasConfliction : function(seq, pos, oldSequence) { var self = this; if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var array = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(array); for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); if (nChar !== "-" && oChar !== "-" && nChar !== oChar) { return true; } } return false; }, _handleConfliction : function(conflictArray) { var self = this; if (conflictArray.length > 0) { var arr = conflictArray[0].split("|"); var bArray = self._getConflictConfirmDialogButtonArray(conflictArray); var dialogTitle = self._options.conflictionDialogTitle + " - " + arr[0] + "[" + arr[1] + "]"; $("#" + self._motifConflictConfirmDialogId).find("input[name='motifReplaceOption'][value='new']").attr("checked", "checked"); var checkBox = $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMin']"); $(checkBox).attr("checked",$(checkBox).is(':checked')); //$("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); $("#" + self._motifConflictConfirmDialogId).dialog({title : dialogTitle}); $("#" + self._motifConflictConfirmDialogId).dialog({buttons : bArray}); $("#" + self._motifConflictConfirmDialogId).dialog("open"); } else { $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAllMotifMin']").attr("checked","checked"); } }, _replaceWithOption : function(option, isApplyToAll, conflictArray) { var self = this; if (isApplyToAll) { self._replaceAllWithOption(option, conflictArray); } else { var value = conflictArray.splice(0, 1); var arr = value[0].split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); self._handleConfliction(conflictArray); } }, _replaceAllWithOption : function(option, conflictArray) { var self = this, html = oldSequence; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } $.each(conflictArray, function(key, conflict) { var arr = conflict.split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); }); }, _replaceSequenceByOption : function(option, seq, pos) { var self = this; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var seqArray = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(seqArray); var html = oldSequence; if (option === "new") { html = self._appSequence.getHtmlByReplacingNewSequence(oldSequence, newSequence); } else if (option === "old") { html = self._appSequence.getHtmlByReplacingOldSequence(oldSequence, newSequence); } self._doReplaceWithHtml(html); }, _getConflictConfirmDialogButtonArray : function(conflictArray) { var self = this; return [ { text: "Done", click : function() { $(this).dialog("close"); var option = $(this).find("input[name='motifReplaceOption']:checked").val(); var isApplyToAll = $(this).find(".motifReplaceApplyToAll").is(":checked"); self._replaceWithOption(option, isApplyToAll, conflictArray); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ]; }, _doReplace : function(seqs, seqArray, posArray) { var self = this; var html = self._appSequence.replace(seqs, seqArray, posArray); self._doReplaceWithHtml(html); }, _doReplaceWithHtml : function(html) { var self = this, sb = []; var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); self._showDataBaseInformationList(); self._options.callback(); }, _addAnotherMotif : function(seq, pos) { var self = this, conflictArray = []; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } if (self._hasConfliction(seq, pos, oldSequence)) { conflictArray.push(seq + "|" + pos); } if (conflictArray.length > 0) { self._handleConfliction(conflictArray); } else { self._replaceSequenceByOption("new", seq, pos); } }, _showPopupWindow : function(url) { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2)); var winTop = parseInt((screen.availHeight/2) - (winHeight/2)); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }, /* _initPositionInsert : function(seq, pos) { var self = this; var mod = seq.length % 2; $("#" + self._motifViewDialogId + " .position").unbind("keyup"); $("#" + self._motifViewDialogId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(Math.abs(val)); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); },*/ /* _initMotifViewDialog : function() { var self = this; $("#" + self._motifViewDialogId).dialog({ autoOpen: false, title: self._default.motifViewDialogTitle, width: 520, dialogClass : self._options.motifViewDialogClass, buttons : [ { text: "Replace", click : function() { var seq = $("#" + self._motifViewDialogId).find(".sequence").val(); var pos = Math.abs($("#" + self._motifViewDialogId).find(".position").val()); var extraCopies = parseInt($("#" + self._motifViewDialogId).find(".extraCopies").val()); var basePairs = parseInt($("#" + self._motifViewDialogId).find(".basePairs").val()); var minPos = parseFloat($("#" + self._motifViewDialogId).find(".minSeq").html()); var maxPos = parseFloat($("#" + self._motifViewDialogId).find(".maxSeq").html()); if (minPos > pos || maxPos < pos) { $dialogError = $("#" + self._motifViewDialogId + " ." + self._options.dialogErrorMessageClass); $dialogError.html(self._options.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); $dialogError.show(); return; } self._appSequence.hideError(); self._replaceWithSequence(seq, pos, extraCopies, basePairs); $(this).dialog("close"); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); },*/ _initAddAnotherMotifDialog : function() { var self = this; $("#" + self._addAnotherMotifDialogId).dialog({ autoOpen: false, title: "Input Motif", buttons : [ { text: "Add", click : function() { var seq = $(this).find(".anotherSequence").val(); var pos = Math.abs($(this).find(".anotherPosition").val()); if (seq && pos) { self._addAnotherMotif(seq, pos); $(this).dialog("close"); } } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, _initMotifConflictConfirmDialog : function() { var self = this; $("#" + self._motifConflictConfirmDialogId).dialog({ autoOpen: false, width: 420, dialogClass : "motifConflictionDialog" }); }, _getMotifMinTriple : function(workId, fileName, property) { var self = this; var index = new Application.index(1, 8000); var minTriple; var getTriplesByProperty = function(tripleList) { var minIndex = -1; var minValue = 99999; $.each (tripleList, function(tKey, tValue) { var tmpValue = parseFloat(tValue.object); if (Math.min(tmpValue, minValue) != minValue) { minValue = tmpValue; minIndex = tKey; } }); if (minIndex != -1) { if (!minTriple) { minTriple = tripleList[minIndex]; } var tmpMinValue = parseFloat(minTriple.object); var currentValue = parseFloat(tripleList[minIndex].object); if (Math.min(tmpMinValue, currentValue) != tmpMinValue) { minTriple = tripleList[minIndex]; } } if (tripleList && tripleList.length == index.getItemCount()) { LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.increment()); } else { self._motifMinSequence(workId, fileName, minTriple.subject, property); } } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index.getIndex()); }, _showMotifMinSequence : function(workId, fileName, propLabel) { var self = this, foundBottomFile = false; var getFilesByTag = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { var tmpName = fName.split("_bottom"); if (fileName.indexOf(tmpName[0]) > -1) { self._getBottomFilePropertyList(workId, fileName, wId, fName, propLabel); foundBottomFile = true; return false; } }); }); if (!foundBottomFile) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._getMotifMinTriple(workId, fileName, property); } } LinkData.getFilesByTag(null, self._tag.bottomResult, getFilesByTag); }, _getBottomFilePropertyList : function(workId, fileName, bottomWorkId, bottomFileName, propLabel) { var self = this; var getProperties = function(propList) { $.each(propList, function(propKey, propValue) { var tmpProp = self._motifProperty._getLabel(propValue); if (tmpProp.indexOf(propLabel) > -1) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._showMotifMin(workId, fileName, property, bottomWorkId, bottomFileName, propValue); return false; } }); } LinkData.getProperties(bottomWorkId, bottomFileName, getProperties); }, _showMotifMin : function(workId, fileName, property, bottomWorkId, bottomFileName, bottomProperty) { var self = this; var index = new Application.index(1, 1000); var getTriplesByProperty = function(tripleList) { self._showMotifMinByTripleList(workId, fileName, property, tripleList); } LinkData.getTriplesByProperty(bottomWorkId, bottomFileName, bottomProperty, getTriplesByProperty, index.getIndex()); }, _showMotifMinByTripleList : function(workId, fileName, property, tripleList) { var self = this, i = 0, subject = tripleList[i].object; var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); var showMinMotif = function(posTripleList) { var found = false; i++; $.each(posTripleList, function(pKey, pValue) { var tmpPos = parseInt(pValue); if (self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos) { found = true; self._motifMinSequence(workId, fileName, subject, property); return false; } }); if (! found) { subject = tripleList[i].object; LinkData.getObjects(workId, fileName, subject, posProperty, showMinMotif); } } LinkData.getObjects(workId, fileName, subject, posProperty, showMinMotif); }, _getDataBaseWebsiteName : function() { var self = this, fileName = self._options.fileName; if (fileName.indexOf(self._options.websiteNameAtted) > -1) { return self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { return self._options.websiteNamePpdb; } else { return "UNKNOWN"; } }, _getGeneType : function() { var self = this, fileName = self._options.fileName; if (fileName.indexOf(self._options.geneTypeAtted) > -1) { return self._options.geneTypeAtted; } else if (fileName.indexOf(self._options.geneTypePpdb) > -1) { return self._options.geneTypePpdb; } else { return "UNKNOWN"; } }, _motifMinSequence : function(workId, fileName, subject, property) { var self = this; var drawSequence = function(seqHtml) { var sb = []; sb[sb.length] = "<input type='hidden' class='" + self._default.geneLabelClass + "' value='" + subject + "'/>"; sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length == 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } self._motifView._initMotifSequenceListener(); self._initReplaceButtonLitener(); self._showDataBaseInformationList(); self._showGenePlot(subject, property); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.resultAreaClass).scrollLeft(10000); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); } self._appSequence.getSequenceHtml(subject, drawSequence); }, /* _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._default.baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; },*/ _getSeqElBySeq : function(seq) { if (seq && seq.trim().length == 7) { return this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length == 8) { return this._octamer.getBySequence(seq); } }, _showDatabaseInfo : function(seqVal) { var self = this, workId = self._options.workId, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var label = self._motifProperty._getDisplayLabel(propLabel); label = (label && label.trim().length != 0) ? label : propLabel; var usedMotif = (seqVal.length != 0) ? seqVal : "-"; var dbInfoHtml = self._getDatabaseInfo(workId, fileName, appName, subject, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); self._previewListener(subject); }, _previewListener : function(subject) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); self._dbPreviewListener(); self._genePreviewListener(subject); self._attedPreviewListener(subject); self._ppdbPreviewListener(gene); self._efpPreviewListener(gene); self._hannaDbPreviewListener(gene); }, _dbPreviewListener : function() { var self = this; var workId = self._options.workId, fileName = self._options.fileName; var url = self._options.serverUrl + "work/" + workId + "/" + fileName + ".html#work_information"; $("#" + self._containerId + " ." + self._options.dbInfoLinkClass).click(function() { self._showPopupWindow(url); }); }, _genePreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() { self._showPopupWindow(subject); }); }, _attedPreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoAttedLinkClass).click(function() { self._showPopupWindow(subject); }); }, _ppdbPreviewListener : function(gene) { var self = this; var url = "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoPpdbLinkClass).click(function() { self._showPopupWindow(url); }); }, _efpPreviewListener : function(gene) { var self = this; var url = "http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi?dataSource=Developmental_Map&modeInput=Absolute&primaryGene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoEfpLinkClass).click(function() { self._showPopupWindow(url); }); }, _hannaDbPreviewListener : function(gene) { var self = this; var url = "http://evolver.psc.riken.jp/seiken/GENE/" + gene.toUpperCase() + ".html"; $("#" + self._containerId + " ." + self._options.geneInfoHannaDbLinkClass).click(function() { self._showPopupWindow(url); }); }, _getDatabaseInfo : function(workId, fileName, method, subject, property, motif) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<span title='" + self._tooltip.getByKey(fileName) + "'>" + fileName + "</span>"; sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.dbInfoLinkClass + "'>LinkData</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Tool</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(self._tooltipName.motifExpress) + "'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Locus</div>"; sb[sb.length] = "<div class='left'>"; //sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.geneInfoLinkClass + "'>" + gene + "</a>"; sb[sb.length] = "<span>" + gene + "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Data and Visualization Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.atted2) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoAttedLinkClass + "'>ATTED-II</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.ppdb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoPpdbLinkClass + "'>PPDB</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.efp) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "'>eFP</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.hanaDb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoHannaDbLinkClass + "'>HanaDB</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Property</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(property) + "'>" + property + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif</div>"; sb[sb.length] = "<div class='left motif'>" + motif + "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, /* _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this, sb = []; //var html = self._appSequence.replaceWith(seq, pos, extraCopies, basePairs); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); self._placeMotifViewSequnce(seq, pos, extraCopies, basePairs); var html = self._appSequence.getReColoredMotifViewSequnce(seq, pos, extraCopies, basePairs, self._options.replaceSequenceClass); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); var seqLabel = seq + "[" + pos + "]"; self._showDatabaseInfo(seqLabel); self._options.callback(); },*/ /* _placeMotifViewSequnce : function(seq, pos, extraCopies, basePairs) { var self =this,conflictArray = []; var corPos; //replaceSequenceByOption var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } for (var j = 0; j < extraCopies + 1; j++) { if (j == 0) { corPos = pos; } else { corPos = corPos + (basePairs) + (seq.length); } if (self._hasConfliction(seq, corPos, oldSequence)) { conflictArray.push(seq + "|" + corPos); } else { self._replaceSequenceByOption("new", seq, corPos); } self._handleConfliction(conflictArray); } //return out.join(""); }*/ }; Application.Util = function() { this._init.apply(this, arguments); } Application.Util.prototype = { _containerId : null, _errTextClass : null, _manualMotifErrorDialogId : null, _baseSequenceMinLength : null, _baseSequenceLength : null, _init : function(args) { this._containerId = args.containerId; this._errTextClass = args.errTextClass; this._baseSequenceMinLength = args.baseSequenceMinLength; this._baseSequenceLength = args.baseSequenceLength; this._motifErrorDialogId = "_manulaMotifMotif_Err_Dialog_" + this._containerId; this._initMotifInitErrDialogView(); this._initMotifErrorDialog(); }, _initMotifInitErrDialogView : function() { var sb = []; sb[sb.length] = "<div id='"+ this._motifErrorDialogId +"' class='hidden'>"; sb[sb.length] = "<div>Following error(s) found while trying to add the add/place the motif</div>"; sb[sb.length] = "<ul class='motiferror'></ul>"; sb[sb.length] = "</br>"; sb[sb.length] = "<div>Would you like to correct it automatically ?</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initMotifErrorDialog : function() { var self = this; $("#" + self._motifErrorDialogId).dialog({ autoOpen: false, width: 600, model: true }); }, _validateManulMotifCenterPosition : function(sequnceLength,position) { if (sequnceLength > 0) { $("#" + this._motifErrorDialogId + " .motiferror").html(""); var corProsition = this.getCalculatedMotifInsertRange(sequnceLength); position = Math.abs(position); if ((position < corProsition.startPoint) || (position > corProsition.endPoint)) { position = corProsition.startPoint; this._putManulMotifError("Defined position is out of range. So assigned the default postion as -" + position); } var val = sequnceLength % 2; position = Math.abs(position); var havingDecimalEntry = (position.toString().indexOf(".") != -1) ? true : false; if (val > 0) { // odd length case if (havingDecimalEntry == true) { position = position.toString().split(".")[0]; this._putManulMotifError("The sequnce lenght is an odd no. For odd lengths, the correct postion should be - " + position); } } else { //even length case if (havingDecimalEntry == false) { position = position + 0.5; this._putManulMotifError("The sequnce lenght is an even no. For even lengths, the correct postion should be - " + position); } else { var decPart = position.toString().split(".")[1]; if (decPart != "5") { position = position.toString().split(".")[0] + ".5"; this._putManulMotifError("The sequnce lenght is an odd no. For odd lengths, the correct postion should be - " + position); } } } } return position; }, _putManulMotifError : function(errInfo) { var errText = $("#" + this._motifErrorDialogId + " .motiferror"); var content = errText.html(); errText.html(content + "</br>" + "<li><span class='"+ this._errTextClass +"'>" + errInfo + "</span></li>"); }, getCalculatedMotifInsertRange : function(sequnceLength) { var centerPos = Math.floor(sequnceLength / 2); var corStartPoint = this._baseSequenceMinLength + centerPos; var corEndPoint = this._baseSequenceLength - centerPos; if (this.isValueEven(sequnceLength) == false) { corStartPoint = corStartPoint + 1; } else { corStartPoint = corStartPoint + 0.5; corEndPoint = corEndPoint + 0.5; } var obj = { startPoint : corStartPoint, endPoint : corEndPoint }; return obj; }, isValueEven : function(val) { var val = val % 2; if (val > 0) { return false; } else { return true; } }, _getMotifEntryErrButtonArray : function(correctPos,textEleRef) { var self = this; return [ { text: "Yes", click : function() { $(textEleRef).val("-" + Math.abs(correctPos)); $(this).dialog("close"); } }, { text: "No", click : function() { $(this).dialog("close"); } } ]; }, _showMotifErrorDialog : function(corectedPos,textEleRef) { var bArray = this._getMotifEntryErrButtonArray(corectedPos,textEleRef); var dialogTitle = "Motif Insert/Place Errors"; $("#" + this._motifErrorDialogId).dialog({title : dialogTitle}); $("#" + this._motifErrorDialogId).dialog({buttons : bArray}); $("#" + this._motifErrorDialogId).dialog("open"); } }; Application.MotifView = function() { this._init.apply(this, arguments); } Application.MotifView.prototype = { _containerId : null, _motifViewAreaId : null, _baseSequenceMinLength : null, _baseSequence : null, _replaceSequenceClass : null, _callerObj : null, _geneLabelClass : null, _motifViewErrDlgId : null, _appUtil : null, _init : function(containerId,args) { date = new Date(); this._containerId = containerId; this._baseSequenceMinLength = args.baseSequenceMinLength; this._baseSequence = args.baseSequence; this._replaceSequenceClass = args.replaceSequenceClass; this._callerObj = args.callerObj; this._geneLabelClass = args.geneLabelClass; this._motifViewAreaId = "motifViewDialog_id_" + this._containerId + "_" + date.getTime(); this._motifViewErrDlgId = "motifViewErrDlg_Id_" + this._containerId + "_" + date.getTime(); //this._initMotivViewErrDialogView(); //this._initMotivViewErrDialog(); this._initAppUtil(); }, defaults : { dialogErrorMessageClass : 'dialogErrorMessage', dialogOutRangeValueMessage : "Please input a value between {0} and {1}", geneLabelClass : "geneUrl" }, /* _initMotivViewErrDialogView : function() { $("#" + this._motifViewErrDlgId).dialog({ resizable: false, modal: true, autoOpen: false, title: 'Invalid Motif Position' }); var buttons = [ { text: "Ok", click : function() { $(this).dialog("close"); } } ]; $("#" + this._motifViewErrDlgId).dialog({buttons:buttons}); }, _initMotivViewErrDialog : function() { $("#" + this._motifViewErrDlgId).dialog({ resizable: false, modal: true, autoOpen: false }); },*/ _initAppUtil : function() { var self = this; var obj = { containerId : self._containerId, errTextClass : 'errorText', baseSequenceMinLength : self._baseSequenceMinLength, baseSequenceLength : self._baseSequence.length } self._appUtil = new Application.Util(obj); }, getMotifViewHtml : function(sequnce) { var sb = [], self = this, date = new Date(); sb[sb.length] = "<fieldset class='motifViewDialog'>"; sb[sb.length] = "<legend>Motif view: edit the position and copy number of a motif</legend>"; sb[sb.length] = "<div id='" + this._motifViewAreaId + "' class='hidden "+ sequnce +"'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation'>Replace with prefer position between "; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; //sb[sb.length] = "<div class='motifImageArea'>"; //sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; //sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation explink'>Click "; //sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<a id='motifview_placeMotif' class='btn btn-lightblue'>Place Motif</a>"; sb[sb.length] = " "; //sb[sb.length] = "<a id='motifview_cancel' class='btn btn-lightblue'>Cancel</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<fieldset class='motifviewinfo'>"; sb[sb.length] = "<span class='motifsequence' /></br>"; sb[sb.length] = "<span class='motifmethod' /></br>"; sb[sb.length] = "<span class='motifrecpos' />"; sb[sb.length] = "</fieldset>"; sb[sb.length] = "</fieldset>"; sb[sb.length] = "</div>"; return sb.join(""); }, drawMotifView : function(sequence,appropriatePos) { var self = this; var htmlContent = this.getMotifViewHtml(sequence); var dialogSelector = "#" + self._motifViewAreaId + "." + sequence; //$("#" + this._containerId).append(htmlContent); $("#" + this._containerId + " ." + self._replaceSequenceClass).before(htmlContent); $(dialogSelector).find(".motifsequence").html("Motif Sequence: " + sequence); $(dialogSelector).find(".motifmethod").html("Motif Method: "); $(dialogSelector).find(".motifrecpos").html("Motif Recommended Position: -" + Math.abs(appropriatePos)); $(dialogSelector).show(); $(dialogSelector).find("#motifview_placeMotif").click(function() { var seq = $(dialogSelector).find(".sequence").val(); var pos = Math.abs($(dialogSelector).find(".position").val()); var extraCopies = parseInt($(dialogSelector).find(".extraCopies").val()); var basePairs = parseInt($(dialogSelector).find(".basePairs").val()); var minPos = parseFloat($(dialogSelector).find(".minSeq").html()); var maxPos = parseFloat($(dialogSelector).find(".maxSeq").html()); //if (minPos > pos || maxPos < pos) { //$("#" + self._motifViewErrDlgId + " .errinfo").html(self.defaults.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); //$dialogError = $("#" + self._motifViewAreaId + " ." + self.defaults.dialogErrorMessageClass); //$dialogError.html(self.defaults.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); //$dialogError.show(); //$("#" + self._motifViewErrDlgId).dialog('open'); //return; //} var position = self._appUtil._validateManulMotifCenterPosition(seq.length,pos); if (Math.abs(pos) != position) { self._appUtil._showMotifErrorDialog(position,$(dialogSelector).find(".position")); } else { $(dialogSelector).find(".position").val("-" + Math.abs(pos)); self._replaceWithSequence(seq, pos, extraCopies, basePairs); } //self.hideError(); //$(this).dialog("close"); }); /* $("#" + this._containerId).find("#motifview_cancel").click(function() { $("#" + self._motifViewDialogId).remove(); });*/ }, _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this, sb = []; self._placeMotifViewSequnce(seq, pos, extraCopies, basePairs); var html = self._callerObj._appSequence.getReColoredMotifViewSequnce(seq, pos, extraCopies, basePairs, self._replaceSequenceClass); var subject = $("#" + self._containerId + " ." + self._geneLabelClass).val(); var gene = self._callerObj._motifProperty.getGeneBySubject(subject); var geneType = ""; if (self._callerObj._getGeneType) { geneType = self._callerObj._getGeneType(); } sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; $("#" + self._containerId + " ." + self._replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._replaceSequenceClass).scrollLeft(10000); var seqLabel = seq + "[" + pos + "]"; self._callerObj._showDatabaseInfo(seqLabel); self._callerObj._options.callback(); }, _placeMotifViewSequnce : function(seq, pos, extraCopies, basePairs) { var self =this,conflictArray = []; var corPos; //replaceSequenceByOption var oldSequence = $("#" + self._containerId + " ." + self.defaults.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self.defaults.resultAreaClass + " .baseSequence").html(); } for (var j = 0; j < extraCopies + 1; j++) { if (j == 0) { corPos = pos; } else { corPos = corPos + (basePairs) + (seq.length); } if (self._callerObj._hasConfliction(seq, corPos, oldSequence)) { conflictArray.push(seq + "|" + corPos); } else { self._callerObj._replaceSequenceByOption("new", seq, corPos); } self._callerObj._handleConfliction(conflictArray); } //return out.join(""); }, isMotifViewExists : function(sequnce) { if ($("#" + this._motifViewAreaId + "."+ sequnce).length > 0) { return true; } else { return false; } }, _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 1 : 0.5; return self._baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod == 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; }, _initPositionInsert : function(seq, pos) { return; var self = this; var mod = seq.length % 2; $("#" + self._motifViewAreaId + " .position").unbind("keyup"); $("#" + self._motifViewAreaId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(Math.abs(val)); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); }, _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { //$("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); //var pos = $(parent).find(".hdnPosition").val(); var pos = $(parent).find(".hdnCorPosition").val(); var appropriatePos = 0; var seqEl = null; if (self._callerObj._getSeqElBySeq) { seqEl = self._callerObj._getSeqElBySeq(seq); appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; } else { appropriatePos = pos; } if (self.isMotifViewExists(seq) == false) { self.drawMotifView(seq,appropriatePos); self._initSequencePopup(seqEl,seq); var dialogSelector = "#" + self._motifViewAreaId + "." + seq; $(dialogSelector + " ." + self.defaults.dialogErrorMessageClass).hide(); $(dialogSelector + " .sequence").val(seq); $(dialogSelector + " .position").val("-" + Math.abs(appropriatePos)); $(dialogSelector + " .extraCopies").val(0); $(dialogSelector + " .basePairs").val(0); $(dialogSelector + " .minSeq").html(self._getMinPosition(seq)); $(dialogSelector + " .maxSeq").html(self._getMaxPosition(seq)); self._initPositionInsert(seq, appropriatePos); $(dialogSelector).show(); } //$("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); //$("#" + self._motifViewDialogId).dialog("open"); //$("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); }, _initSequencePopup : function(seqEl,sequence) { var self = this; var dialogSelector = "#" + self._motifViewAreaId + "." + sequence; $(dialogSelector + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; if (url == "#") { $(dialogSelector + " .explink").html(" "); } else { $(dialogSelector + " .explink").show(); } $(dialogSelector + " .moreInfo").click(function() { self._callerObj._showPopupWindow(url); }); } }; Application.geneChart = function() { this._init.apply(this, arguments); }; Application.geneChart.prototype = { _containerId : null, _options : null, _workId : null, _fileName : null, _subject : null, _property : null, _highChartContainerId : null, _appProperty : null, _default : { filterNamespace : "http://linkdata.org/", acceptPropLabelPrefix : "label:" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._workId = this._options.workId; this._fileName = this._options.fileName; this._subject = this._options.subject; this._property = this._options.property; var date = new Date(); this._highChartContainerId = "gene_chart_" + date.getTime(); this._initAppProperty(this._options); this._initView(); this._drawHighChart(this._subject, this._property); }, _initAppProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._appProperty = new Application.motifProperty(obj); }, _initView : function() { var self = this; var sb = []; sb[sb.length] = "<div id='" + self._highChartContainerId + "'></div>"; $("#" + self._containerId).html(sb.join("")); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _drawHighChart : function(subject, highlightProperty) { var self = this; var getDataArray = function(tripleList) { var dataArray = []; var dataObject = {}; var array = []; var duplicateProperty = []; $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var val = parseFloat(tValue.object); if (highlightProperty === property) { val = self._getHighLightColumn(parseFloat(tValue.object)); } array.push(val); duplicateProperty.push(property); } }); dataObject.name = self._getLabel(subject); dataObject.data = array; dataArray.push(dataObject); self._getXCategory(tripleList, dataArray, highlightProperty); } LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray); }, _getXCategory : function(tripleList, dataArray, highlightProperty) { var self = this; var array = []; var duplicateProperty = []; var hLabel = self._getLabelAfterHash(highlightProperty); $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var displayLabel = self._getDisplayLabel(label); var hDisplayLabel = self._getDisplayLabel(hLabel); if (displayLabel === hDisplayLabel) { displayLabel = "<span style=\"color:#FB3B44\">" + hDisplayLabel + "</span>"; } array.push(displayLabel); duplicateProperty.push(property); } }); self._drawChart(self._highChartContainerId, dataArray, array); }, _getHighLightColumn : function(val) { var obj = {}; obj.y = val; obj.marker = { lineWidth: 3, lineColor: "#FB3B44", fillColor: "#FB3B44" }; return obj; }, _drawChart : function(containerId, dataArray, xCategory) { var self = this; var chart = new Highcharts.Chart({ chart: { renderTo: containerId, type: 'line', marginRight: 130, marginBottom: 125 }, title: { text: self._fileName }, xAxis: { categories: xCategory, labels : { rotation: 315 } }, tooltip: { formatter: function() { return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']'; } }, legend: { layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0 }, series: dataArray }); }, _getLabel : function(value) { var self = this, label; if (value.indexOf("#") > -1) { label = self._getLabelAfterHash(value); } else { label = self._appProperty.getGeneBySubject(value); } if (!label) { label = value; } return label; }, _getPropertyLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); propLabel = this._appProperty.getPropertyNameByLabel(propLabel); } return propLabel; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _optionArray : null, _default : { acceptPropLabelPrefix : "label:", subjectATTEDUriPhrase : "http://atted.jp/data/locus/", subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; var method = function(properties) { self._fillPropMap(self, properties); self._initOptionArray(properties); } LinkData.getProperties(workId, fileName, method); }, _fillPropMap : function(self, properties) { $.each(properties, function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initOptionArray : function(propertyList) { var self = this, list = new Object(); var workId = self._options.workId, fileName = self._options.fileName; self._optionArray = []; $.each(propertyList, function(key, value) { var propLabel = self._getLabel(value); if (!self._ignore(propLabel)) { var obj = {}; obj.key = propLabel; obj.value = self._getDisplayLabel(propLabel); self._optionArray.push(obj); } }); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { return this._optionArray; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getGeneBySubject : function(subject) { var self = this, htmlExt = ".html", geneLabel; if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, ""); } else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, ""); } if (geneLabel && geneLabel.indexOf(htmlExt) > -1) { geneLabel = geneLabel.replace(htmlExt, ""); } return geneLabel; } }; Application.sequence = function() { this._init.apply(this, arguments); }; Application.sequence.prototype = { CHAR_SEQ_EMPTY : "-", _options : null, _workId : null, _fileName : null, _seqProperty : null, _posProperty : null, _baseSequence : null, _sequenceList : null, _positionList : null, _containerId : null, _errorContainerClass : null, _outOfRangeArray : null, _default : { msgInvalidSequence: "invalid sequence.", msgOutOfRangeSequence: "out of range sequence : {0}", }, _init : function(options) { this._options = options; this._workId = this._options.workId; this._fileName = this._options.fileName; this._seqProperty = this._options.motifSequenceProperty; this._posProperty = this._options.motifPositionProperty; this._baseSequence = this._options.baseSequence; this._containerId = this._options.containerId; this._errorContainerClass = this._options.errorMessageClass; }, _getCustomSequenceHtml : function(baseSequence, sequence, position) { var seqLen = sequence.length; var tHold = Math.floor(seqLen / 2); var pos = parseInt(position); var baseSeqLen = baseSequence.length; var suffixLen = baseSeqLen - (tHold + pos); var motifCorectedStartingPoint = position - (seqLen / 2); var sb = []; if (motifCorectedStartingPoint >= this._options.baseSequenceMinLength && suffixLen >= 0) { for (var i = 0; i < suffixLen; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>"); sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>"); sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>"); sb.push("<input type='hidden' class='hdnCorPosition' value='-" + position + "'/>"); } else { //_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence)); this._outOfRangeArray.push(sequence + "[-" + position + "]"); this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.join(", "))); } return sb.join(""); }, _isValidSequenceList : function(seqs) { var count = seqs.length; var maxlength = 0; for (var i = 0; i < count; i++) { if (seqs[i].length > maxlength) { maxlength = seqs[i].length; } } var result = true; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i)); } if (! this._isValidChars(chars.join(""))) { result = false; break; } } return result; }, _isValidBaseReplacementMotif : function(baseSequence, seqs) { var self = this; var mergeSequence = this._getMergeCharSequence(seqs); var length = baseSequence.length; for (var i = 0; i < length; i++) { var bChar = baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY && bChar !== this.CHAR_SEQ_EMPTY && mChar !== bChar) { return false; } } return true; }, _isValidChars : function(charString) { var charLen = charString.length; var result = true; var first = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) == this.CHAR_SEQ_EMPTY) { continue; } if (! first) { first = charString.charAt(i); } var current = charString.charAt(i); if (current && first != current) { result = false; break; } } return result; }, _getReplacedCustomSequence : function(seqs) { var mergeSequence = this._getMergeCharSequence(seqs); var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var bChar = this._baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY) { // replaced sb.push(mChar); } else { sb.push(bChar); } } return sb.join(""); }, _getMergeCharSequence : function(seqs) { var count = seqs.length; var maxlength = this._baseSequence.length; var sb = []; for (var i = 0; i < maxlength; i++) { var chars = []; for (var j = 0; j < count; j++) { chars.push(seqs[j].charAt(i) ? seqs[j].charAt(i) : this.CHAR_SEQ_EMPTY); } sb.push(this._getMergeChar(chars.join(""))); } return sb.join(""); }, _getMergeChar : function(charString) { var charLen = charString.length; var result = null; for (var i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { result = charString.charAt(i); break; } } if (!result) { result = this.CHAR_SEQ_EMPTY; } return result; }, _wrappedReplacedSequenceHtml : function(replaceSequence, seqs) { var self = this, sb = []; var mergeSequence = this._getMergeCharSequence(seqs); var length = this._baseSequence.length; for (var i = 0; i < length; i++) { var bChar = this._baseSequence.charAt(i); var rChar = replaceSequence.charAt(i); var mChar = mergeSequence.charAt(i); var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar; if (mChar !== this.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(seqChar); } } return sb.join(""); }, /* _getSequenceAndPositionHiddenHtml : function(seqArray, posArray) { var self = this, sb = []; if (!seqArray || !posArray) { return sb.join(""); } for (var i = 0; i < seqArray.length; i++) { sb[sb.length] = "<input type='hidden' class='hdnReplacedMotif' value='" + seqArray[i] + "|" + posArray[i] + "'/>"; } return sb.join(""); }, */ _showError : function(message) { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass); $errorMessageContainer.html(message); $errorMessageContainer.show(); }, getHtmlByReplacingOldSequence : function(oldSequence, newSequence) { var self = this, sb = []; for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); var seqChar = (oChar !== nChar) ? "<span class='replace'>" + oChar + "</span>" : oChar; if (nChar !== self.CHAR_SEQ_EMPTY) { if (oChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(nChar); } } else { sb.push(oChar); } } return sb.join(""); }, getHtmlByReplacingNewSequence : function(oldSequence, newSequence) { var self = this, sb = []; for (var i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(oChar); } } return sb.join(""); }, getSequenceHtml : function(subject, drawSequence) { var self = this; self._outOfRangeArray = []; var sb = [], baseSequence = self._baseSequence; var getTriplesBySequenceProperty = function(sequenceList) { self._getTriplesBySequenceProperty(subject, drawSequence, sequenceList); } LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty, getTriplesBySequenceProperty); }, _getTriplesBySequenceProperty : function(subject, drawSequence, sequenceList) { var self = this; var getTriplesByPositionProperty = function(positionList) { self._drawSequenceList(drawSequence, sequenceList, positionList); } LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty, getTriplesByPositionProperty); }, _drawSequenceList : function(drawSequence, sequenceList, positionList) { var self = this, sb = []; if (!sequenceList || sequenceList.length == 0) { return; } for (var i = 0; i < sequenceList.length; i++) { var customSeqString = self._getCustomSequenceHtml(self._baseSequence, sequenceList[i], positionList[i]); if (customSeqString.length > 0) { sb.push("<div>"); sb.push("<div class='userSequence'>" + customSeqString + "</div>"); sb.push(" <span class='deletelink "+ sequenceList[i] +"' onclick='self._deleteUserSequence("+ """ + sequenceList[i] + """ +","+ """ + self._containerId + """ +");'>"); sb.push("<img src='http://app.linkdata.org/asset/c6bf2a0f.png' title='Delete' /></span>"); //sb.push("<div> </div>"); sb.push("</div>"); } } sb.push("<div> </div>"); drawSequence(sb.join("\n")); }, _deleteUserSequence : function(sequence) { alert(sequence); //$("#" + this._containerId + " .resultArea .userSequence").each(function() { /// var seq = $(this).find(".hdnSequence"); //}); }, getFormattedSequence : function(baseSeqLen, seq, pos) { var self = this, sb = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2); var pos = parseInt(pos); var len = baseSeqLen - (tHold + pos); for (var i = 0; i < len; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } sb[sb.length] = seq; return sb.join(""); }, replace : function(seqs, seqArray, posArray) { var self = this, isValid = self._isValidSequenceList(seqs); if (isValid) { if (seqs.length > 0) { var sb = []; var replaceSeq = self._getReplacedCustomSequence(seqs); sb[sb.length] = self._wrappedReplacedSequenceHtml(replaceSeq, seqs); //sb[sb.length] = self._getSequenceAndPositionHiddenHtml(seqArray, posArray); return sb.join(""); } } else { this._showError(self._default.msgInvalidSequence); } }, replaceWith : function(seq, pos, extraCopies, basePairs) { var main = [], seqArray = [], posArray = [], conflictArray = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2); var pos = parseInt(pos); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - (tHold + pos); var corPos; seqArray.push(seq); posArray.push(pos); for (var j = 0; j < extraCopies + 1; j++) { var array = []; for (var i = 0; i < len; i++) { array.push(this.CHAR_SEQ_EMPTY); } array.push(seq); main.push(array.join("")); len = len - seqLen - basePairs; if (len < 0) { break; } } //return this.replace(main, seqArray, posArray); return main; }, getReplacingSeq : function(seq,pos) { var sb = [], out = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2); var pos = parseInt(pos); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - (tHold + pos); for (var i = 0; i < len; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push(seq); return sb.join(""); }, getReColoredMotifViewSequnce : function(seq, pos, extraCopies, basePairs, replaceDivClass) { var self = this; var sb = []; var seqs = self.replaceWith(seq, pos, extraCopies, basePairs); var replaceSeq = self._getReplacedCustomSequence(seqs); var existingSequence = $("#" + self._containerId + " ." + replaceDivClass).text(); var repSeqLen = replaceSeq.length; for (var index = 0 ; index < repSeqLen ; index++) { var oChar = existingSequence.charAt(index); var nChar = replaceSeq.charAt(index); //var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (index < (repSeqLen - 50)) { if (nChar == oChar && nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence replace'>" + nChar + "</span>"); } else { sb.push(oChar); } } else { sb.push(oChar); } } //self._doReplaceWithHtml(sb.join("")); return sb.join(""); }, /* hideError : function() {Seq.charAt(index); //var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (index < (exisSeqLen - 50)) { if (nChar == oChar && nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence replace'>" + nChar + "</span>"); } else { sb.push(oChar); } } else { sb.push(oChar); } } //self._doReplaceWithHtml(sb.join("")); return sb,join(""); },*/ hideError : function() { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide(); } }; Application.heptamer = function() { this._init.apply(this, arguments); }; Application.heptamer.prototype = { _heptamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { heptamerTag : "heptamer", filterSequencePropertyPhrase : "motif_sequence", filterMaxCEGPropertyPhrase : "maxCEG", filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)" }, _init : function() { this._heptamerMap = []; this._initHeptamerList(); }, _initHeptamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initHeptamer(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._default.heptamerTag, getFilesByTag); }, _initHeptamer : function(workId, fileName) { var self = this; var getPropertyList = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); } LinkData.getProperties(workId, fileName, getPropertyList); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillHeptamerMap(workId, fileName, sequenceTripleList); } LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillHeptamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { for (var i = 0; i < sequenceTripleList.length; i++) { var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[i]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._heptamerMap[seqTriple.object] = seqEl; } } LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._heptamerMap[sequence]; } }; Application.octamer = function() { this._init.apply(this, arguments); } Application.octamer.prototype = { _octamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { octamerTag : "octamer", filterSequencePropertyPhrase : "sequence", filterAppropriatePosition : "Appropriate%20position" }, _init : function() { this._octamerMap = []; this._initOctamerList(); }, _initOctamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initOctamer(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, self._default.octamerTag, getFilesByTag); }, _initOctamer : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); } LinkData.getProperties(workId, fileName, getProperties); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillOctamerMap(workId, fileName, sequenceTripleList); } LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillOctamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { for (var i = 0; i < sequenceTripleList.length; i++) { var j = Math.floor(i / 2); var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[j]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._octamerMap[seqTriple.object] = seqEl; } } LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._octamerMap[sequence]; } }; Application.seqElement = function() { this._init.apply(this, arguments); }; Application.seqElement.prototype = { _externalUrl : null, _sequence : null, _appropriatePos : null, _init : function() {}, getExternalUrl : function() { return this._externalUrl; }, setExternalUrl : function(externalUrl) { this._externalUrl = externalUrl; }, getSequence : function() { return this._sequence; }, setSequence : function(sequence) { this._sequence = sequence; }, getAppropriatePos : function() { return this._appropriatePos; }, setAppropriatePos : function(appropriatePos) { this._appropriatePos = appropriatePos; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; } }; Application.index = function() { this._init.apply(this, arguments); } Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); return false; }); }); } LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); } LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); } LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); } LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; for (var i = 0; i < subjectList.length; i++) { var key = self._getLabelAfterHash(subjectList[i]); if (tripleList[i]) { var value = tripleList[i].object; self._addToolTip(key, value); } } if (subjectList && subjectList.length == index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key === key) { tooltip = obj.tooltip; return false; } }); return (tooltip) ? tooltip : ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; $(document).ready(function() { var fillDatabase = function(resultList) { $(".motifMaxDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>"); $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { $(".motifMaxDatabase").append("<option value='" + workId + "|" + fileName + "'>" + fileName + "</option>"); }); }); var execute = function(dbKey, applicationOption) { if (dbKey == -1) { $("#container").html(""); return; } var array = dbKey.split("|"); var containerId = "container"; var options = { workId : array[0], fileName : array[1], applicationOption : applicationOption, //replaceMotifArray : ["ATGGCAC|74", "GGGATGG|77"], //baseSequence : "GAAAAAAGACGTTCCAACCACGTCTTCAAAGCAAGTGATTGGATTAAGGTTCTTCCACACGGTAAGGGATGGCACTAACACCTACCATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" //baseSequence : "------------------------------------------------------------------GGGATGGCAC---------------------GACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" baseSequence : "--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACCTCGAC" }; new Application.motifExpress(containerId, options); } $(".motifMaxDatabase").change(function() { var dbKey = $("option:selected", $(this)).val(); var applicationOption = $('input[name=option]:checked').val(); execute(dbKey, applicationOption); }); $('input[name=option]').click(function() { $("#container").html(""); var dbKey = $("option:selected", $(".motifMaxDatabase")).val(); execute(dbKey, $(this).val()); }); } LinkData.getFilesByTag(null, "database", fillDatabase); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } .row { padding: 5px 0; } .row:after { content: ""; clear: left; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .highlight-sequence { font-weight: bold; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; white-space: nowrap; } .replaceSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; width: 100%; overflow: auto; white-space: nowrap; } .replace { color: #E80010; } .errorMessage { color: #FF0000; text-align: center; } .databaseInfo .motif { width: 70%; } /** * button css */ .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; margin-left : 200px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .basePairs, .motifViewDialog .extraCopies, .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; } .loadingImageContainer .loadingMessage { color: #FF0000; } .motifConflictionDialog .option { margin: 10px; } .motifViewDialog { margin-top: 10px; } .motifViewDialog .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; width : 200px; } .motifViewDialog .motifviewinfo { float: right; margin-top: -150px; position: relative; width: 300px; } .deletelink { cursor: pointer; } .deletelink img { margin-bottom: -3px; }
<div class="row"> <div class="label left">Select Database</div> <div class="left"><select class="motifMaxDatabase"></select></div> </div> <div class="row"> <div class="label left">Application Option</div> <div class="left"> <input type="radio" name="option" value="max" checked="checked"/> Max <input type="radio" name="option" value="min"/> Min </div> </div> <div id="container"></div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Full
Contributor:GenoCon
Update:Mar 6, 2013
6639 Downloads, 32 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Flowering.html#work_information'>AtGenExpress_ATTED_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Fruit_Seeds.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Leaf.html#work_information'>AtGenExpress_ATTED_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Root.html#work_information'>AtGenExpress_ATTED_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Seedling.html#work_information'>AtGenExpress_ATTED_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Stem.html#work_information'>AtGenExpress_ATTED_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/AtGenExpress_ATTED_Whole_Plant.html#work_information'>AtGenExpress_ATTED_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s328i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering
[
database
]
AtGenExpress_ATTED_Fruit_Seeds
AtGenExpress_ATTED_Leaf
AtGenExpress_ATTED_Root
AtGenExpress_ATTED_Seedling
AtGenExpress_ATTED_Stem
AtGenExpress_ATTED_Whole_Plant
Heptamer_elements
[
heptamer
]
PPDB_position
Speedup Lists of Developmental Coexpression (AtGenExpress + ATTED-II promoter motif) Gene
Contributor:GenoCon
Update:Jan 15, 2013
2266 Downloads, 24 Applications
Lists for the AtGenExpress and ATTEDII mashup data table. For each experiment, the top 1000 and bottom 1000 genes ranked by absolute expression level. This also includes the full List for MotifQuery function. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <!-- <b> Captions for properties of data tables: </b> <table style='text-align:left;'> <tr> <th nowrap> label:Conditions </th> <td> The genes ranked by absolute expression level under the given growth conditions. </td> </tr> </table> <br> <br> --> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_top.html#work_information'>AtGenExpress_ATTED_top</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the top 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_bottom.html#work_information'>AtGenExpress_ATTED_bottom</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the bottom 1000 genes ranked by absolute expression level. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s339i/AtGenExpress_ATTED_all.html#work_information'>AtGenExpress_ATTED_all</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the all genes ranked by absolute expression level. </td> </tr> </table>
AtGenExpress_ATTED_all
AtGenExpress_ATTED_bottom
[
result_bottom
]
AtGenExpress_ATTED_top
[
result_top
]
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s150i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
Work
Add
Clear
insert work id or work name.