Language
Login
Language Setting
X
English
日本語 [Japanese]
about this App
motifRanking Ver.2
useful
0
Loading...
MotifRanking= function(containerId, options) { var app = new Application.motifRanking(containerId, options); }; if (Application === "undefined" || !Application) { var Application = {}; } Application.motifRanking = function() { this._init.apply(this, arguments); }; Application.motifRanking.prototype = { _containerId : null, _baseSequence : null, _options : null, _tooltip : null, _motifProperty : null, _heptamer : null, _octamer : null, _appSequence : null, //_motifConflict : null, _motifViewDialogId : null, _addAnotherMotifDialogId : null, _motifConflictConfirmDialogId : null, _geneInfoContainerId : null, _motifView : null, _fixedSequence : null, _rankingOrder : null, _dataColl : null, _rankListWorkId : null, _plotingWorkId : null, _default : { appName : "MotifRanking", selectPropertyCaption : "Select Property", selectPropertyAreaClass : "selectPropertyArea", selectPropertyClass : "selectProperty", // 発現ランキング関係の定数 selectRankingCaption : "Expression Ranking", selectRankingAreaClass : "selecRankingArea", selectRankingClass : "selectRanking", rankingRange : 10, // 順序選択関係の定数 selectOrderCaption : "Order", selectOrderAreaClass : "selectOrderArea", selectOrderName : "selectOrder", topValue : "top", bottomValue : "bottom", topLabel : "Top", bottomLabel : "Bottom", resultAreaClass : "resultArea", replaceButtonAreaClass : "replaceButtonArea", replaceButtonClass : "replaceButton", nextButtonAreaClass : "nextButtonArea", replaceSequenceClass : "replaceSequence", fixedSequenceShowClass : "fixedSequenceMotif", wrappedMotifSequenceShowClass : "wrappedSequenceMotif", errorMessageAreaClass : "errorMessage", dialogErrorMessageClass : "dialogErrorMessage", dialogOutRangeValueMessage : "Please input a value between {0} and {1}", databaseInfoClass : "databaseInfo", addAnotherMotifButtonClass : "addAnotherMotifButton", geneLabelClass : "geneUrl", dbInfoLinkClass : "dbInfoLink", geneInfoLinkClass : "geneInfoLink", geneInfoAttedLinkClass : "geneInfoAttedLink", geneInfoPpdbLinkClass : "geneInfoPpdbLink", geneInfoEfpLinkClass : "geneInfoEfpLink", geneInfoHannaDbLinkClass : "geneInfoHannaDbLink", motifSequenceProperty : "motif sequence", motifPositionProperty : "motif position", typeProperty : "type", validType : "REG", motifViewDialogId : "motifViewDialog", motifViewDialogClass : "motifViewDialog", motifViewDialogTitle : "Motif View", conflictionDialogTitle : "Confliction", minSequenceClass : "minSeq", maxSequenceClass : "maxSeq", websiteNameAtted : "ATTED", websiteNamePpdb : "PPDB", geneTypeAtted : "ATTED", geneTypePpdb : "PPDB", baseSequenceMinLength : 50, dialogImageUrl : "http://app.linkdata.org/asset/a06f4de4.png", callback : function() {}, loadingImageContainer : "loadingImageContainer", loadingImageUrl : "http://app.linkdata.org/asset/67556085.gif", loadingMessageClass : "loadingMessage", loadingMessage : "Loading linked data...", loadingMessageError : "There was an error with loading Linked data. Please refresh the browser", serverUrl : "http://linkdata.org/", resultAreaUserMessage : "Scroll Left/Right to inspect motifs from this promoter. Click on a motif sequence to enter the advanced motif view.", resultAreaUserMessageClass : "resultAreaUserMessageClass" }, _tag : { topResult : "result_top", bottomResult : "result_bottom", speedupDb : "motifexpress" }, _tooltipName : { selectProperty : "Select Property", atted2 : "atted-ii", hanaDb : "HanaDB", efp : "eFP", ppdb : "ppdb", replace : "replace", manuallyInputMotif : "userinputmotif", motifRanking : "motifranking", motifCircatian : "motifcircadian", addMotifs : "Add Motifs", ranking : "ranking", topOrBottom : "top/bottom" }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._baseSequence = this._options.baseSequence; this._fixedSequence = this._options.fixedSequence; var date = new Date(); this._geneInfoContainerId = "gene_info_containerId_" + date.getTime(); this._dataColl = this._options.dataColl; this._rankListWorkId = this._options.rankListWorkId; this._plotingWorkId = this._options.plotingWorkId; this._initToolTip(); this._initMotifProperty(this._options); this._initAppSequence(this._options); this._initExternalLinks(); this._initMotifView(this._options); this._initHeptamer(); this._initOctamer(); this._initView(); this._initDialog(); this._initAppOption(); }, _initAppOption : function() { var sb =[]; sb[sb.length] = ""; }, _initExternalLinks : function() { // set as "MotifExpress" because MotifRanking should having the same data as MotifExpress this._extLinks = new Application.externalLink("MotifExpress"); }, _initToolTip : function() { var self = this; self._tooltip = self._options.tooltip || new Application.tooltip(); }, _initMotifProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._motifProperty = new Application.motifProperty(obj); }, _initMotifView : function(opts) { var self = this; var obj = { baseSequenceMinLength : opts.baseSequenceMinLength, baseSequence : opts.baseSequence, replaceSequenceClass : opts.replaceSequenceClass, callerObj : self, geneLabelClass : opts.geneLabelClass, motifMethod : opts.motifMethod }; this._motifView = new Application.MotifView(this._containerId,obj); }, _initAppSequence : function(opts) { var self = this; var timer = new Application.timer(); var init = function() { var seqProperty = self._motifProperty.getPropertyByLabel(self._options.motifSequenceProperty); var posProperty = self._motifProperty.getPropertyByLabel(self._options.motifPositionProperty); if (seqProperty && posProperty) { var obj = { workId : opts.workId, fileName : opts.fileName, baseSequence : self._baseSequence, motifSequenceProperty : seqProperty, motifPositionProperty : posProperty, containerId : self._containerId, errorMessageClass : self._options.errorMessageAreaClass, baseSequenceMinLength : self._options.baseSequenceMinLength, fixedSequence : self._options.fixedSequence }; self._appSequence = new Application.sequence(obj); } else { timer.call(init); } }; init(); }, _initHeptamer : function() { this._heptamer = new Application.heptamer(); }, _initOctamer : function() { this._octamer = new Application.octamer(); }, _initView : function() { this._initMainView(); this._initAddAnotherMotifDialogView(); this._initConflictConfirmDialogView(); }, _initDialog : function() { this._initAddAnotherMotifDialog(); this._initMotifConflictConfirmDialog(); }, _initMainView : function() { var self = this; var timer = new Application.timer(); var fillOptionMethod = function() { var optionArray = self._motifProperty.getOptionArray(); if (optionArray) { var sb = []; sb[sb.length] = "<div class='" + self._options.selectPropertyAreaClass + " row'>"; sb[sb.length] = "<div class='label left' title='" + self._tooltip.getByKey(self._tooltipName.selectProperty) + "'>" + self._options.selectPropertyCaption + "</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<select class='" + self._options.selectPropertyClass + "' title='" + self._tooltip.getByKey(self._tooltipName.selectProperty) + "'>"; sb[sb.length] = "<option value='" + -1 + "' title='" + self._tooltip.getByKey(self._tooltipName.selectProperty) + "'>-- Select Property --</option>"; $.each(optionArray, function(key, obj) { // removing the data collection part if exists var text = ""; if (obj.value.indexOf(self._dataColl) > -1) { text = obj.value.substring((self._dataColl.length + 1)); } else { text = obj.value; } sb[sb.length] = "<option value='" + obj.key + "' title='" + self._tooltip.getByKey(obj.value) + "'>" + text + "</option>"; }); sb[sb.length] = "</select>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; // 順序の選択のためのエリア sb[ sb.length ] = "<div class='" + self._options.selectOrderAreaClass + " row hidden'>"; sb[ sb.length ] = " <div class='label left'>" + self._options.selectOrderCaption + "</div>"; sb[ sb.length ] = " <div class='left' title='" + self._tooltip.getByKey(self._tooltipName.topOrBottom) + "'>"; sb[ sb.length ] = " <lable><input name='" + self._options.selectOrderName + "' type='radio' value='" + self._options.topValue +"'>"; sb[ sb.length ] = self._options.topLabel + self._options.rankingRange + "</label>"; sb[ sb.length ] = " <label><input name='" + self._options.selectOrderName + "' type='radio' value='"+ self._options.bottomValue +"'>"; sb[ sb.length ] = self._options.bottomLabel + self._options.rankingRange + "</label>"; sb[ sb.length ] = " </div>"; sb[ sb.length ] = "</div>"; //発現ランキングのエリア sb[ sb.length ] = "<div class='" + self._options.selectRankingAreaClass + " row hidden'>"; sb[ sb.length ] = " <div class='label left'>" + self._options.selectRankingCaption + "</div>"; sb[ sb.length ] = " <div class='left'>"; sb[ sb.length ] = " <select class='" + self._options.selectRankingClass + "' "; sb[ sb.length ] = "title='" + self._tooltip.getByKey(self._tooltipName.ranking) + "'>"; sb[ sb.length ] = " <option value='" + -1 + "'>-- Select Gene --</option>"; sb[ sb.length ] = " </select>"; sb[ sb.length ] = " </div>"; sb[ sb.length ] = "</div>"; sb[sb.length] = "<div class='" + self._options.databaseInfoClass + " hidden'></div>"; sb[sb.length] = "<div id='" + self._geneInfoContainerId + "'></div>"; sb[sb.length] = "<div class='" + self._options.errorMessageAreaClass + " hidden'>error</div>"; sb[sb.length] = "<div class='" + self._options.resultAreaClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.resultAreaUserMessageClass + " hidden'>"+ self._options.resultAreaUserMessage +"</div>"; sb[sb.length] = "<div class='" + self._options.replaceButtonAreaClass + " hidden'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.addMotifs) + "' class='" + self._options.replaceButtonClass + " btn btn-lightblue'>Add Motifs</a> "; //sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.manuallyInputMotif) + "' class='" + self._options.addAnotherMotifButtonClass + " btn btn-lightblue'>Manually Input Motif</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='" + self._options.replaceSequenceClass + " hidden'></div>"; sb[sb.length] = "<div class='" + self._options.wrappedMotifSequenceShowClass + " hidden'></div>"; sb[sb.length] = "<span class='" + self._options.fixedSequenceShowClass + " hidden'></span>"; sb[sb.length] = "<div class='" + self._options.loadingImageContainer + " hidden' align='center'>"; sb[sb.length] = "<div class='" + self._options.loadingMessageClass + "'>" + self._options.loadingMessage + "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<img src='" + self._options.loadingImageUrl + "'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + self._containerId).html(sb.join("")); self._initListener(); self._scrollDown(); } else { timer.call(fillOptionMethod); } }; fillOptionMethod(); }, _initAddAnotherMotifDialogView : function() { var sb = [], self = this, date = new Date(); this._addAnotherMotifDialogId = "addAnotherMotifDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + this._addAnotherMotifDialogId + "' class='hidden'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Motif Sequence</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherSequence'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='left'>Position(-550 to -50)</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<input type='text' class='anotherPosition'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initConflictConfirmDialogView : function() { var sb = [], self = this, date = new Date(); self._motifConflictConfirmDialogId = "motifConflictConfirmDialog_id_" + self._containerId + "_" + date.getTime(); sb[sb.length] = "<div id='" + self._motifConflictConfirmDialogId + "' class='hidden'>"; sb[sb.length] = "<div>New motif overlaps with old one. Which one should be kept in overalp regions?</div>"; sb[sb.length] = "<div class='option'>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='new'/> New</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='old'/> Old</label></div>"; sb[sb.length] = "<div><label><input type='radio' name='motifReplaceOption' value='discard'/> Discard new motif</label></div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<label><input type='checkbox' checked=checked class='motifReplaceApplyToAll' value='applytoall'/> Apply to all</label>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initListener : function() { var self = this; self._initSelectPropertyListener(); self._initAddAnotherMotifButtonListener(); self._initRankingListener(); self._initSelectOrderListener(); }, /* プロパティ選択時 */ _initSelectPropertyListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var setSelectListener = function() { if ($("#" + self._containerId + " ." + self._options.selectPropertyClass).length !== 0) { $("#" + self._containerId + " ." + self._options.selectPropertyClass).change(function() { // すでに後続の部品がすでに表示されている場合に備え、それらを一旦隠す。 self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.selectRankingAreaClass ).hide(); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); $("#" + self._containerId + " ." + self._options.resultAreaUserMessageClass).hide(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); $("#" + self._containerId + " #" + self._geneInfoContainerId).hide(); $( "#" + self._containerId + " [name=" + self._options.selectOrderName + "]" ).attr( "checked", false ); // 選択されたのが「-- Select Property --」でなければ if( $( this ).val() !== "-1" ) { $( "#" + self._containerId + " ." + self._options.selectOrderAreaClass ).show(); } self._scrollDown(); } ); } else { timer.call(setSelectListener); } }; setSelectListener(); }, _initAddAnotherMotifButtonListener : function() { var self = this; $("#" + self._containerId + " ." + self._options.addAnotherMotifButtonClass).click(function() { self._appSequence.hideError(); $("#" + self._addAnotherMotifDialogId + " .anotherSequence").val(""); $("#" + self._addAnotherMotifDialogId + " .anotherPosition").val(""); $("#" + self._addAnotherMotifDialogId).dialog("open"); }); }, _showGenePlot : function(workId, fileName, subject, property) { var self = this; var plotWorkId; if (self._plotingWorkId == "-") { plotWorkId = workId; } else { plotWorkId = self._plotingWorkId } $("#" + self._containerId + " #" + self._geneInfoContainerId).show(); var options = { workId : plotWorkId, fileName : self._getPlotFileName(fileName), originalFileName : fileName, subject : subject, property : property, appName : self._options.appName, dataCollection : self._dataColl, geneLocus : self._motifProperty.getGeneBySubject(subject) }; var app = new Application.geneChart(self._geneInfoContainerId, options); }, _getPlotFileName : function(fileName) { if (fileName.indexOf("_mean") != -1) { var strComp = fileName.split("_mean"); return strComp[0]; } else if (fileName.indexOf("_median") != -1) { var strComp = fileName.split("_median"); return strComp[0]; } else { return fileName; } }, _showDataBaseInformationList : function() { var self = this, seqVal = []; $("#" + self._containerId + " .userSequence .hdnSequence").each(function() { var tmpPos = $(this).siblings(".hdnCorPosition").val(); seqVal.push($(this).val() + "[" + tmpPos + "]"); }); self._showDatabaseInfo(seqVal.join(", ")); }, _initReplaceButtonLitener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; $("#" + self._containerId + " ." + self._options.replaceButtonClass).unbind("click"); $("#" + self._containerId + " ." + self._options.replaceButtonClass).click(function() { var seqs = [], nonConflictSeqs = [], seqArray = [], posArray = [], conflictArray = []; $("#" + self._containerId + " .userSequence").each(function() { seqs.push($(this).text()); var seq = $(this).find(".hdnSequence").val(); var pos = $(this).find(".hdnPosition").val(); seqArray.push(seq); posArray.push(pos); if (self._hasConfliction(seq, pos)) { conflictArray.push(seq + "|" + pos); } else { nonConflictSeqs.push($(this).text()); } }); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); if (conflictArray.length > 0) { if (nonConflictSeqs.length > 0) { self._doReplace(nonConflictSeqs, seqArray, posArray); } self._handleConfliction(conflictArray); } else { self._doReplace(seqs, seqArray, posArray); } self._scrollDown(); }); }, _scrollDown : function() { $("html, body").animate({ scrollTop: $(document).height() }, 1000); }, _initRankingListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var setSelectListener = function() { if($( "#" + self._containerId + " ." + self._options.selectRankingClass ).length !== 0 ) { $( "#" + self._containerId + " ." + self._options.selectRankingClass ).change( function() { $( "#" + self._containerId + " ." + self._options.loadingImageContainer ).show(); // すでに後続の部品がすでに表示されている場合に備え、それらを一旦隠す。 self._appSequence.hideError(); $( "#" + self._containerId + " ." + self._options.resultAreaClass ).hide(); $( "#" + self._containerId + " ." + self._options.replaceButtonAreaClass ).hide(); $( "#" + self._containerId + " ." + self._options.resultAreaUserMessageClass).hide(); $( "#" + self._containerId + " ." + self._options.replaceSequenceClass ).hide(); $( "#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $( "#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $( "#" + self._containerId + " ." + self._options.databaseInfoClass ).hide(); $( "#" + self._containerId + " #" + self._geneInfoContainerId ).hide(); // 選択されたのが「-- Select Gene --」でなければ if( $( this ).val() !== "-1" ) { $( "#" + self._containerId + " ." + self._options.loadingImageContainer ).show(); var subject = $( "option:selected", this ).val(); var propLabel = $( "#" + self._containerId + " ." + self._options.selectPropertyClass + " option:selected" ).val(); propLabel = self._motifProperty.getPropertyByLabel(propLabel); self._motifSequence( workId, fileName, subject, propLabel ); } } ); } else { timer.call( setSelectListener ); } }; setSelectListener(); }, _initSelectOrderListener : function() { var self = this, workId = self._options.workId, fileName = self._options.fileName; var timer = new Application.timer(); var $select = $( "#" + self._containerId + " [name=" + self._options.selectOrderName + "]" ); var setSelectListener = function() { if( $select.length !== 0 ) { $select.change( function() { self._rankingOrder = $( this ).val(); /* ロード中の表示 */ $( "#" + self._containerId + " ." + self._options.loadingImageContainer ).show(); // すでに後続の部品がすでに表示されている場合に備え、それらを一旦隠す。 self._appSequence.hideError(); $("#" + self._containerId + " ." + self._options.selectRankingAreaClass ).hide(); $("#" + self._containerId + " ." + self._options.resultAreaClass).hide(); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); $("#" + self._containerId + " ." + self._options.resultAreaUserMessageClass).hide(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(""); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).hide(); $("#" + self._containerId + " ." + self._options.databaseInfoClass).hide(); $("#" + self._containerId + " #" + self._geneInfoContainerId).hide(); var propLabel = $( "#" + self._containerId + " ." + self._options.selectPropertyClass + " option:selected" ).val(); // ランキング生成へ self._showMotifSequence( workId, fileName, propLabel ); } ); } else { timer.call( setSelectListener ); } }; setSelectListener(); }, _hasConfliction : function(seq, pos, oldSequence) { var self = this; var i; if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var array = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(array); for ( i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); if (nChar !== "-" && oChar !== "-" && nChar !== oChar) { return true; } } return false; }, _handleConfliction : function(conflictArray) { var self = this; if (conflictArray.length > 0) { var arr = conflictArray[0].split("|"); var bArray = self._getConflictConfirmDialogButtonArray(conflictArray); var dialogTitle = self._options.conflictionDialogTitle + " - " + arr[0] + "[" + arr[1] + "]"; $("#" + self._motifConflictConfirmDialogId).find("input[name='motifReplaceOption'][value='new']").attr("checked", "checked"); var checkBox = $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAll']"); $(checkBox).attr("checked",$(checkBox).is(':checked')); //$("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); $("#" + self._motifConflictConfirmDialogId).dialog({title : dialogTitle}); $("#" + self._motifConflictConfirmDialogId).dialog({buttons : bArray}); $("#" + self._motifConflictConfirmDialogId).dialog("open"); } else { $("#" + self._motifConflictConfirmDialogId).find("input[class='motifReplaceApplyToAll']").attr("checked", "checked"); } }, _replaceWithOption : function(option, isApplyToAll, conflictArray) { var self = this; if (isApplyToAll) { self._replaceAllWithOption(option, conflictArray); $("#" + self._motifConflictConfirmDialogId).find(".motifReplaceApplyToAll").attr("checked", "checked"); } else { var value = conflictArray.splice(0, 1); var arr = value[0].split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); self._handleConfliction(conflictArray); } }, _replaceAllWithOption : function(option, conflictArray) { var self = this, html = oldSequence; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } $.each(conflictArray, function(key, conflict) { var arr = conflict.split("|"); self._replaceSequenceByOption(option, arr[0], arr[1]); }); }, _replaceSequenceByOption : function(option, seq, pos) { var self = this; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } var formattedSeq = self._appSequence.getFormattedSequence(self._baseSequence.length, seq, pos); var seqArray = [formattedSeq]; var newSequence = self._appSequence._getMergeCharSequence(seqArray); var html = oldSequence; if (option === "new") { html = self._appSequence.getHtmlByReplacingNewSequence(oldSequence, newSequence); } else if (option === "old") { html = self._appSequence.getHtmlByReplacingOldSequence(oldSequence, newSequence); } self._doReplaceWithHtml(html); }, _getConflictConfirmDialogButtonArray : function(conflictArray) { var self = this; return [ { text: "Done", click : function() { $(this).dialog("close"); var option = $(this).find("input[name='motifReplaceOption']:checked").val(); var isApplyToAll = $(this).find(".motifReplaceApplyToAll").is(":checked"); self._replaceWithOption(option, isApplyToAll, conflictArray); } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ]; }, _doReplace : function(seqs, seqArray, posArray) { var self = this; var html = self._appSequence.replace(seqs, seqArray, posArray); self._doReplaceWithHtml(html); }, _doReplaceWithHtml : function(html) { var wrappedHtml = this._getAddedSquenceWithoutFixedSequence(html); var self = this, sb = []; var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var gene = self._motifProperty.getGeneBySubject(subject); var geneType = self._getGeneType(); sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; //self._appSequence.hideError(); //$("#" + self._containerId + " ." + self._options.replaceSequenceClass).show(); //$("#" + self._containerId + " ." + self._options.fixedSequenceShowClass).show(); $("#" + self._containerId + " ." + self._options.wrappedMotifSequenceShowClass).show(); $("#" + self._containerId + " ." + self._options.replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._options.wrappedMotifSequenceShowClass).html(wrappedHtml); //$("#" + self._containerId + " ." + self._options.fixedSequenceShowClass).html(this._fixedSequence); //$("#" + self._containerId + " ." + self._options.replaceSequenceClass).scrollLeft(10000); //$("#" + self._containerId + " ." + self._options.wrappedMotifSequenceShowClass).scrollDown(10000); var ref = $("#" + self._containerId + " ." + self._options.wrappedMotifSequenceShowClass); $(ref).animate({scrollTop: $(ref).height()}, 800); self._showDataBaseInformationList(); self._options.callback(); }, _getAddedSquenceWithoutFixedSequence : function(html) { var index = html.lastIndexOf(this._fixedSequence); var length = index + this._fixedSequence.length; if( html.length === length ) //if (html.length = length) { html = html.substr(0,index); } return html; }, _addAnotherMotif : function(seq, pos) { var self = this, conflictArray = []; var oldSequence = $("#" + self._containerId + " ." + self._options.replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self._options.resultAreaClass + " .baseSequence").html(); } if (self._hasConfliction(seq, pos, oldSequence)) { conflictArray.push(seq + "|" + pos); } if (conflictArray.length > 0) { self._handleConfliction(conflictArray); } else { self._replaceSequenceByOption("new", seq, pos); } }, _showPopupWindow : function(url) { var winWidth = 800; var winHeight = 800; var winLeft = parseInt((screen.availWidth/2) - (winWidth/2), 10); var winTop = parseInt((screen.availHeight/2) - (winHeight/2), 10); var winStyle = "width=" + winWidth + ",height=" + winHeight + ",left=" + winLeft + ",top=" + winTop + ",screenX=" + winLeft + ",screenY=" + winTop + ",scrollbars=1"; window.open(url, "Motif", winStyle); }, _initAddAnotherMotifDialog : function() { var self = this; $("#" + self._addAnotherMotifDialogId).dialog({ autoOpen: false, title: "Input Motif", buttons : [ { text: "Add", click : function() { var seq = $(this).find(".anotherSequence").val(); var pos = Math.abs($(this).find(".anotherPosition").val()); if (seq && pos) { self._addAnotherMotif(seq, pos); $(this).dialog("close"); } } }, { text: "Cancel", click : function() { $(this).dialog("close"); } } ] }); }, _initMotifConflictConfirmDialog : function() { var self = this; $("#" + self._motifConflictConfirmDialogId).dialog({ autoOpen: false, width: 420, dialogClass : "motifConflictionDialog" }); }, _getMotifTriple : function(workId, fileName, property) { var self = this; // まずは8000件を読み込む var index = new Application.index(1, 8000); var totalList = []; var getTriplesByProperty = function( tripleList ) { // 新たに読み込んだtripleの配列を連結 totalList = totalList.concat( tripleList ); // まだ続きがあれば次の8000件を読み込む if( tripleList && tripleList.length === index.getItemCount() ) { //再帰的に繰り返し。 LinkData.getTriplesByProperty( workId, fileName, property, getTriplesByProperty, index.increment() ); } else { var i; var subjects = []; var len = totalList.length; var cnt = 0; // 順序を切り替えるための係数 var sign = ( self._rankingOrder === self._options.topValue ) ? 1 : -1; // 発現量でソート totalList.sort( function( a, b ) { return (b.object - a.object) * sign; } ); // 所定の個数のsubjectが集まるか、全subjectを読み切るまでループ for( i = 0; i < len && cnt < self._options.rankingRange; i++ ) { // 重複のチェック var j; for( j = 0; j < cnt; j++ ) { if( totalList[ i ].subject === subjects[ j ] ) { break; } } // 重複がなければランキングに追加 if( j === cnt ) { subjects[ cnt++ ] = totalList[ i ].subject; } } self._showRanking( subjects ); } }; //データベースからtriplesを読み込み、getTriplesByPropertyにそれを渡す。 LinkData.getTriplesByProperty( workId, fileName, property, getTriplesByProperty, index.getIndex() ); }, _monitorAppDataLoading : function() { var self = this; var maxRetry = 200; // 200 seconds var timer = new Application.timer(); timer.setMaxRetryCount(maxRetry); var checkLoadingArea = function() { if (maxRetry === 0) { if (LinkData.activeAjaxConnections > 0) { maxRetry = 10; timer.call(checkLoadingArea); } else { $("#" + self._containerId + " ." + self._options.loadingMessageClass).html(self._options.loadingMessageError); $("#" + self._containerId + " ." + self._options.loadingImageContainer + " img").hide(); return; } } //var dbInfoArea = $("#" + self._containerId + " ." + self._options.databaseInfoClass); var dbRankingArea = $("#" + self._containerId + " ." + self._options.selectRankingAreaClass ); //if (!$(dbInfoArea).is(":visible")) { if (!$(dbRankingArea).is(":visible")) { timer.call(checkLoadingArea); } else { return; } maxRetry--; }; checkLoadingArea(); }, /* ランキング生成処理の入り口 */ _showMotifSequence : function(workId, fileName, propLabel ) { var self = this, foundAbstFile = false; var getFilesByTag = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { if (wId == self._rankListWorkId) { self._getAbstFilePropertyList(workId, fileName, wId, fName, propLabel ); foundAbstFile = true; return false; } /* var tmpName; if( self._rankingOrder === self._options.topValue ) { tmpName = fName.split("_top"); } else { tmpName = fName.split("_bottom"); } if (fileName.indexOf(tmpName[0]) > -1) { self._getAbstFilePropertyList(workId, fileName, wId, fName, propLabel ); foundAbstFile = true; return false; }*/ }); }); if (!foundAbstFile) { var property = self._motifProperty.getPropertyByLabel(propLabel); self._getMotifTriple(workId, fileName, property); } }; self._monitorAppDataLoading(); /* if( self._rankingOrder === self._options.topValue ) { LinkData.getFilesByTag(null, self._tag.topResult, getFilesByTag); } else { LinkData.getFilesByTag(null, self._tag.bottomResult, getFilesByTag); }*/ LinkData.getFilesByTag(null, self._tag.speedupDb, getFilesByTag); }, _getAbstFilePropertyList : function(workId, fileName, abstWorkId, abstFileName, propLabel) { var self = this; var getProperties = function(propList) { $.each(propList, function(propKey, propValue) { var tmpProperty = self._motifProperty._getLabel(propValue); if (tmpProperty.indexOf(propLabel) > -1) { var property = self._motifProperty.getPropertyByLabel(propLabel); //self._showMotif(workId, fileName, property, abstWorkId,abstFileName, propValue); self._prepareIndexandShowMotif(workId, fileName, property, abstWorkId,abstFileName, propValue); } }); }; LinkData.getProperties(abstWorkId, abstFileName, getProperties); }, _prepareIndexandShowMotif : function(workId, fileName, property, abstWorkId,abstFileName, propValue) { var self = this; if( self._rankingOrder === self._options.topValue ) { var index = new Application.index(1, 1000); self._showMotif(workId, fileName, property, abstWorkId,abstFileName, propValue, index); } else { var getSubjectsCount = function(count) { var index = null; if (count > 1000) { index = new Application.index((count-1000),count); } else { index = new Application.index(1,1000); } self._showMotif(workId, fileName, property, abstWorkId,abstFileName, propValue, index); } LinkData.getSubjectsCount(abstWorkId,abstFileName,getSubjectsCount); } }, _showMotif : function(workId, fileName, property, abstWorkId, abstFileName, abstProperty, index) { var self = this; //var index = new Application.index(1, 1000); var getTriplesByProperty = function(tripleList) { self._showMotifByTripleList(workId, fileName, property, tripleList); }; LinkData.getTriplesByProperty( abstWorkId, abstFileName, abstProperty, getTriplesByProperty, index.getIndex()); }, _showMotifByTripleList : function( workId, fileName, property, tripleList ) { var self = this, i = 0, subject = tripleList [ i ].object; var cnt = 0; var subjects = []; var posProperty = self._motifProperty.getPropertyByLabel( self._options.motifPositionProperty ); var showMotif = function( posTripleList ) { var found = false; i++; $.each( posTripleList, function( pKey, pValue ) { var tmpPos = parseInt( pValue, 10 ); // モチーフの位置がベース配列の範囲内に収まっていれば if( self._options.baseSequenceMinLength < tmpPos && self._options.baseSequence.length >= tmpPos ) { // 発見のフラグを立てる。 found = true; return false; } } ); if( found ) { var j; // 適合するモチーフをランキングのための配列に追加 for( j = 0; j < cnt; j++ ) { if( subject === subjects[ j ] ) { break; } } if( j === cnt ) { subjects[ cnt++ ] = subject; } } if( cnt < self._options.rankingRange ) { // 次のtripleへ。 subject = tripleList[ i ].object; LinkData.getObjects( workId, fileName, subject, posProperty, showMotif ); } else { // 規定数の遺伝子が集まった場合はランキング生成へ self._showRanking( subjects ); } }; LinkData.getObjects( workId, fileName, subject, posProperty, showMotif ); }, //発現ランキングの生成 _showRanking : function( subjects ) { var self = this; var $select = $( "#" + self._containerId + " ." + self._options.selectRankingClass ); $( "option", $select ).remove(); $select.append( "<option value='-1'>-- Select Gene --</option>" ); $.each( subjects, function( tKey, tValue ) { var gene = self._motifProperty.getGeneBySubject( tValue ); $select.append( "<option value='" + tValue + "'>" + ( tKey + 1 ) + ":" + gene + "</option>" ); } ); $( "#" + self._containerId + " ." + self._options.loadingImageContainer ).hide(); $( "#" + self._containerId + " ." + self._options.selectRankingAreaClass ).show(); }, _getDataBaseWebsiteName : function() { var self = this; var fileName = self._options.fileName; var rtn; if (fileName.indexOf(self._options.websiteNameAtted) > -1) { rtn = self._options.websiteNameAtted; } else if (fileName.indexOf(self._options.websiteNamePpdb) > -1) { rtn = self._options.websiteNamePpdb; } else { rtn = "UNKNOWN"; } return rtn; }, _getGeneType : function() { var self = this, fileName = self._options.fileName; var rtn; if (fileName.indexOf(self._options.geneTypeAtted) > -1) { rtn = self._options.geneTypeAtted; } else if (fileName.indexOf(self._options.geneTypePpdb) > -1) { rtn = self._options.geneTypePpdb; } else { rtn = "UNKNOWN"; } return rtn; }, _motifSequence : function(workId, fileName, subject, property) { var self = this; var drawSequence = function(seqHtml) { var sb = []; sb[sb.length] = "<input type='hidden' class='" + self._default.geneLabelClass + "' value='" + subject + "'/>"; sb[sb.length] = "<div class='baseSequence'>" + self._baseSequence + "</div>"; sb[sb.length] = seqHtml; $("#" + self._containerId + " ." + self._options.resultAreaClass).html(sb.join("")); if (seqHtml.length === 0) { $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).hide(); } self._motifView._initMotifSequenceListener(); self._initReplaceButtonLitener(); self._showDataBaseInformationList(); self._showGenePlot(workId, fileName, subject, property); $("#" + self._containerId + " ." + self._options.resultAreaClass).show(); $("#" + self._containerId + " ." + self._options.resultAreaClass).scrollLeft(10000); $("#" + self._containerId + " ." + self._options.replaceButtonAreaClass).show(); $("#" + self._containerId + " ." + self._options.resultAreaUserMessageClass).show(); $("#" + self._containerId + " ." + self._options.loadingImageContainer).hide(); self._scrollDown(); }; self._appSequence.getSequenceHtml(subject, drawSequence); }, _getSeqElBySeq : function(seq) { var rtn; if (seq && seq.trim().length === 7) { rtn = this._heptamer.getBySequence(seq); } else if (seq && seq.trim().length === 8) { rtn = this._octamer.getBySequence(seq); } return rtn; }, _showDatabaseInfo : function(seqVal) { var self = this, workId = self._options.workId, fileName = self._options.fileName, appName = self._options.appName; var propLabel = $("option:selected", "#" + self._containerId + " ." + self._options.selectPropertyClass).val(); var subject = $("#" + self._containerId + " ." + self._options.geneLabelClass).val(); var label = self._motifProperty._getDisplayLabel(propLabel); label = (label && label.trim().length !== 0) ? label : propLabel; var usedMotif = (seqVal.length !== 0) ? seqVal : "-"; var dbInfoHtml = self._getDatabaseInfo(workId, fileName, appName, subject, label, usedMotif); $("#" + self._containerId + " ." + self._options.databaseInfoClass).html(dbInfoHtml); $("#" + self._containerId + " ." + self._options.databaseInfoClass).show(); self._previewListener(subject); }, _previewListener : function(subject) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); self._dbPreviewListener(); self._initExternalLinksListner(gene); }, _initExternalLinksListner : function(gene) { var self = this; $("#" + this._containerId + " .externalLink").click(function() { var curGene = gene; var url = $(this).attr("linkurl"); if (!(url)) return; var geneCase = $(this).attr("genecase"); if (geneCase == "U") { curGene = gene.toUpperCase(); } url = url.replace("{0}",curGene); self._showPopupWindow(url); }) }, _dbPreviewListener : function() { var self = this; var workId = self._options.workId, fileName = self._options.fileName; var url = self._options.serverUrl + "work/" + workId + "/" + fileName + ".html#work_information"; $("#" + self._containerId + " ." + self._options.dbInfoLinkClass).click(function() { self._showPopupWindow(url); }); }, _genePreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoLinkClass).click(function() { self._showPopupWindow(subject); }); }, _attedPreviewListener : function(subject) { var self = this; $("#" + self._containerId + " ." + self._options.geneInfoAttedLinkClass).click(function() { self._showPopupWindow(subject); }); }, _ppdbPreviewListener : function(gene) { var self = this; var url = "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=" + gene.toString().toUpperCase(); $("#" + self._containerId + " ." + self._options.geneInfoPpdbLinkClass).click(function() { self._showPopupWindow(url); }); }, _efpPreviewListener : function(gene) { var self = this; var url = "http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi?dataSource=Developmental_Map&modeInput=Absolute&primaryGene=" + gene; $("#" + self._containerId + " ." + self._options.geneInfoEfpLinkClass).click(function() { self._showPopupWindow(url); }); }, _hannaDbPreviewListener : function(gene) { var self = this; var url = "http://evolver.psc.riken.jp/seiken/GENE/" + gene.toUpperCase() + ".html"; $("#" + self._containerId + " ." + self._options.geneInfoHannaDbLinkClass).click(function() { self._showPopupWindow(url); }); }, _getDatabaseInfo : function(workId, fileName, method, subject, property, motif) { var self = this; var gene = self._motifProperty.getGeneBySubject(subject); var sb = []; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Database</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<span title='" + self._tooltip.getByKey(fileName) + "'>" + fileName + "</span>"; sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.dbInfoLinkClass + "'>LinkData</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Tool</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(self._tooltipName.motifRanking) + "'>" + method + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Locus</div>"; sb[sb.length] = "<div class='left'>"; //sb[sb.length] = "<a href='javascript:void(0);' class='externalLink " + self._options.geneInfoLinkClass + "'>" + gene + "</a>"; sb[sb.length] = "<span>" + gene + "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; /*sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif Analysis Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.atted2) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoAttedLinkClass + "'>ATTED-II</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.ppdb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoPpdbLinkClass + "'>PPDB</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Gene Expression Visualization Links</div>"; sb[sb.length] = "<div class='left'>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.efp) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "'>eFP</a>"; sb[sb.length] = "<a title='" + self._tooltip.getByKey(self._tooltipName.hanaDb) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoHannaDbLinkClass + "'>HanaDB</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "</div>";*/ this._prepareExternalLinks(sb); sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Property</div>"; sb[sb.length] = "<div class='left' title='" + self._tooltip.getByKey(property) + "'>" + property + "</div>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<div class='label left'>Motif</div>"; sb[sb.length] = "<div class='left motif'>" + motif + "</div>"; sb[sb.length] = "</div>"; return sb.join(""); }, _prepareExternalLinks : function(htmlArray) { var self = this; var categoryNames = this._extLinks._getDistinctCategories(); for (var index = 0 ; index < categoryNames.length ; index++) { var categoryName = categoryNames[index]; var links = this._extLinks._getExternalLinksForCategory(categoryName); htmlArray[htmlArray.length] = "<div class='row'>"; htmlArray[htmlArray.length] = "<div class='label left'>"+ categoryName +"</div>"; for (var i = 0 ; i < links.length ; i++) { var linkInfo = links[i]; htmlArray[htmlArray.length] = "<div class='left'>"; htmlArray[htmlArray.length] = "<a title='" + self._tooltip.getByKey(linkInfo.linkName) + "' href='javascript:void(0);' class='externalLink " + self._options.geneInfoEfpLinkClass + "' linkurl='"+ linkInfo.url +"' genecase='"+ linkInfo.geneCase +"'>"+ linkInfo.linkName +"</a>"; htmlArray[htmlArray.length] = "</div>"; } htmlArray[htmlArray.length] = "</div>"; } } }; Application.Util = function() { this._init.apply(this, arguments); }; Application.Util.prototype = { _containerId : null, _errTextClass : null, _manualMotifErrorDialogId : null, _baseSequenceMinLength : null, _baseSequenceLength : null, _init : function(args) { this._containerId = args.containerId; this._errTextClass = args.errTextClass; this._baseSequenceMinLength = args.baseSequenceMinLength; this._baseSequenceLength = args.baseSequenceLength; this._motifErrorDialogId = "_manulaMotifMotif_Err_Dialog_" + this._containerId; this._initMotifInitErrDialogView(); this._initMotifErrorDialog(); }, _initMotifInitErrDialogView : function() { var sb = []; sb[sb.length] = "<div id='"+ this._motifErrorDialogId +"' class='hidden'>"; sb[sb.length] = "<div>Following error(s) found while trying to add the add/place the motif</div>"; sb[sb.length] = "<ul class='motiferror'></ul>"; sb[sb.length] = "</br>"; sb[sb.length] = "<div>Would you like to correct it automatically ?</div>"; sb[sb.length] = "</div>"; $("#" + this._containerId).append(sb.join("")); }, _initMotifErrorDialog : function() { var self = this; $("#" + self._motifErrorDialogId).dialog({ autoOpen: false, width: 600, model: true }); }, _validateManulMotifCenterPosition : function(sequnceLength,position) { if (sequnceLength > 0) { $("#" + this._motifErrorDialogId + " .motiferror").html(""); var corProsition = this.getCalculatedMotifInsertRange(sequnceLength); position = Math.abs(position); if ((position < corProsition.startPoint) || (position > corProsition.endPoint)) { position = corProsition.startPoint; this._putManulMotifError("Defined position is out of range. So assigned the default postion as -" + position); } var val = sequnceLength % 2; position = Math.abs(position); var havingDecimalEntry = (position.toString().indexOf(".") !== -1) ? true : false; if (val > 0) { // odd length case if (havingDecimalEntry === true) { position = position.toString().split(".")[0]; this._putManulMotifError("The sequnce lenght is an odd no. For odd lengths, the correct postion should be - " + position); } } else { //even length case if (havingDecimalEntry === false) { position = position + 0.5; this._putManulMotifError("The sequnce lenght is an even no. For even lengths, the correct postion should be - " + position); } else { var decPart = position.toString().split(".")[1]; if (decPart !== "5") { position = position.toString().split(".")[0] + ".5"; this._putManulMotifError("The sequnce lenght is an odd no. For odd lengths, the correct postion should be - " + position); } } } } return position; }, _putManulMotifError : function(errInfo) { var errText = $("#" + this._motifErrorDialogId + " .motiferror"); var content = errText.html(); errText.html(content + "</br>" + "<li><span class='"+ this._errTextClass +"'>" + errInfo + "</span></li>"); }, getCalculatedMotifInsertRange : function(sequnceLength) { var centerPos = Math.floor(sequnceLength / 2); var corStartPoint = this._baseSequenceMinLength + centerPos; var corEndPoint = this._baseSequenceLength - centerPos; if (this.isValueEven(sequnceLength) === false) { corStartPoint = corStartPoint + 1; } else { corStartPoint = corStartPoint + 0.5; corEndPoint = corEndPoint + 0.5; } var obj = { startPoint : corStartPoint, endPoint : corEndPoint }; return obj; }, isValueEven : function(val) { var rtn; val = val % 2; if (val > 0) { rtn = false; } else { rtn = true; } return rtn; }, _getMotifEntryErrButtonArray : function(correctPos,textEleRef) { var self = this; return [ { text: "Yes", click : function() { $(textEleRef).val("-" + Math.abs(correctPos)); $(this).dialog("close"); } }, { text: "No", click : function() { $(this).dialog("close"); } } ]; }, _showMotifErrorDialog : function(corectedPos,textEleRef) { var bArray = this._getMotifEntryErrButtonArray(corectedPos,textEleRef); var dialogTitle = "Motif Insert/Place Errors"; $("#" + this._motifErrorDialogId).dialog({title : dialogTitle}); $("#" + this._motifErrorDialogId).dialog({buttons : bArray}); $("#" + this._motifErrorDialogId).dialog("open"); } }; Application.MotifView = function() { this._init.apply(this, arguments); }; Application.MotifView.prototype = { _containerId : null, _motifViewAreaId : null, _baseSequenceMinLength : null, _baseSequence : null, _replaceSequenceClass : null, _callerObj : null, _geneLabelClass : null, _motifViewErrDlgId : null, _appUtil : null, _motifMethod : null, _init : function(containerId,args) { date = new Date(); this._containerId = containerId; this._baseSequenceMinLength = args.baseSequenceMinLength; this._baseSequence = args.baseSequence; this._replaceSequenceClass = args.replaceSequenceClass; this._callerObj = args.callerObj; this._geneLabelClass = args.geneLabelClass; this._motifMethod = args.motifMethod; this._motifViewAreaId = "motifViewDialog_id_" + this._containerId + "_" + date.getTime(); this._motifViewErrDlgId = "motifViewErrDlg_Id_" + this._containerId + "_" + date.getTime(); //this._initMotivViewErrDialogView(); //this._initMotivViewErrDialog(); this._initAppUtil(); }, defaults : { dialogErrorMessageClass : 'dialogErrorMessage', dialogOutRangeValueMessage : "Please input a value between {0} and {1}", geneLabelClass : "geneUrl" }, /* _initMotivViewErrDialogView : function() { $("#" + this._motifViewErrDlgId).dialog({ resizable: false, modal: true, autoOpen: false, title: 'Invalid Motif Position' }); var buttons = [ { text: "Ok", click : function() { $(this).dialog("close"); } } ]; $("#" + this._motifViewErrDlgId).dialog({buttons:buttons}); }, _initMotivViewErrDialog : function() { $("#" + this._motifViewErrDlgId).dialog({ resizable: false, modal: true, autoOpen: false }); },*/ _initAppUtil : function() { var self = this; var obj = { containerId : self._containerId, errTextClass : 'errorText', baseSequenceMinLength : self._baseSequenceMinLength, baseSequenceLength : self._baseSequence.length }; self._appUtil = new Application.Util(obj); }, getMotifViewHtml : function(sequnce) { var sb = [], self = this, date = new Date(); sb[sb.length] = "<fieldset class='motifViewDialog'>"; sb[sb.length] = "<legend>Motif view: edit the position and copy number of a motif</legend>"; sb[sb.length] = "<div id='" + this._motifViewAreaId + "' class='hidden "+ sequnce +"'>"; sb[sb.length] = "<input type='hidden' class='sequence'>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Place motif at position</span>"; sb[sb.length] = "<input type='text' class='position'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='explanation left'>Place motif with center position between <br/>"; sb[sb.length] = "<span class='minSeq'></span> and <span class='maxSeq'>"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Number of extra copies</span>"; sb[sb.length] = "<input type='text' class='extraCopies' value='0'/>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div class='row'>"; sb[sb.length] = "<span class='label left'>Space between copies (Base Pairs)</span>"; sb[sb.length] = "<input type='text' class='basePairs' value='0'/>"; sb[sb.length] = "</div>"; //sb[sb.length] = "<div class='motifImageArea'>"; //sb[sb.length] = "<img src='" + this._options.dialogImageUrl + "'/>"; //sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='explanation explink'>Click "; //sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif from " + self._getDataBaseWebsiteName() + " website"; sb[sb.length] = "<a class='moreInfo'>here</a> to see the additional information about motif"; sb[sb.length] = "</span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<span class='dialogErrorMessage errorMessage hidden'></span>"; sb[sb.length] = "</div>"; sb[sb.length] = "<div>"; sb[sb.length] = "<a id='motifview_placeMotif' class='btn btn-lightblue'>Place Motif</a>"; sb[sb.length] = " "; //sb[sb.length] = "<a id='motifview_cancel' class='btn btn-lightblue'>Cancel</a>"; sb[sb.length] = "</div>"; sb[sb.length] = "<fieldset class='motifviewinfo'>"; sb[sb.length] = "<div style='float:left'>Motif Sequence:</div>"; sb[sb.length] = "<div class='motifviewsequence'></div>"; sb[sb.length] = "<div style='width=100%;float:left'>"; //sb[sb.length] = "<span class='motifsequence' /></br>"; sb[sb.length] = "<span class='motifmethod' /></br>"; sb[sb.length] = "<span class='motifrecpos' />"; sb[sb.length] = "</div>"; sb[sb.length] = "</fieldset>"; sb[sb.length] = "</fieldset>"; sb[sb.length] = "</div>"; return sb.join(""); }, drawMotifView : function(sequence,appropriatePos) { var self = this; var htmlContent = this.getMotifViewHtml(sequence); var dialogSelector = "#" + self._motifViewAreaId + "." + sequence; //$("#" + this._containerId).append(htmlContent); $("#" + this._containerId + " ." + self._replaceSequenceClass).before(htmlContent); $(dialogSelector).find(".motifviewsequence").html(sequence); $(dialogSelector).find(".motifmethod").html("Motif Type: " + this._motifMethod); $(dialogSelector).find(".motifrecpos").html("Motif default position: -" + Math.abs(appropriatePos)); $(dialogSelector).show(); $(dialogSelector).find("#motifview_placeMotif").click(function() { var seq = $(dialogSelector).find(".sequence").val(); var pos = Math.abs($(dialogSelector).find(".position").val()); var extraCopies = parseInt($(dialogSelector).find(".extraCopies").val(), 10); var basePairs = parseInt($(dialogSelector).find(".basePairs").val(), 10); var minPos = parseFloat($(dialogSelector).find(".minSeq").html()); var maxPos = parseFloat($(dialogSelector).find(".maxSeq").html()); //if (minPos > pos || maxPos < pos) { //$("#" + self._motifViewErrDlgId + " .errinfo").html(self.defaults.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); //$dialogError = $("#" + self._motifViewAreaId + " ." + self.defaults.dialogErrorMessageClass); //$dialogError.html(self.defaults.dialogOutRangeValueMessage.replace("{0}", minPos).replace("{1}", maxPos)); //$dialogError.show(); //$("#" + self._motifViewErrDlgId).dialog('open'); //return; //} var position = self._appUtil._validateManulMotifCenterPosition(seq.length,pos); if (Math.abs(pos) !== position) { self._appUtil._showMotifErrorDialog(position,$(dialogSelector).find(".position")); } else { $(dialogSelector).find(".position").val("-" + Math.abs(pos)); self._replaceWithSequence(seq, pos, extraCopies, basePairs); } //self.hideError(); //$(this).dialog("close"); }); /* $("#" + this._containerId).find("#motifview_cancel").click(function() { $("#" + self._motifViewDialogId).remove(); });*/ }, _replaceWithSequence : function(seq, pos, extraCopies, basePairs) { var self = this, sb = []; self._placeMotifViewSequnce(seq, pos, extraCopies, basePairs); var html = self._callerObj._appSequence.getReColoredMotifViewSequnce(seq, pos, extraCopies, basePairs, self._replaceSequenceClass); self._callerObj._doReplaceWithHtml(html); /* var subject = $("#" + self._containerId + " ." + self._geneLabelClass).val(); var gene = self._callerObj._motifProperty.getGeneBySubject(subject); var geneType = ""; if (self._callerObj._getGeneType) { geneType = self._callerObj._getGeneType(); } sb[sb.length] = html; sb[sb.length] = "<input type='hidden' class='gene' value='" + gene + "'/>"; sb[sb.length] = "<input type='hidden' class='geneType' value='" + geneType + "'/>"; $("#" + self._containerId + " ." + self._replaceSequenceClass).html(sb.join("")); $("#" + self._containerId + " ." + self._replaceSequenceClass).show(); $("#" + self._containerId + " ." + self._replaceSequenceClass).scrollLeft(10000); var seqLabel = seq + "[" + pos + "]"; self._callerObj._showDatabaseInfo(seqLabel); self._callerObj._options.callback();*/ }, _placeMotifViewSequnce : function(seq, pos, extraCopies, basePairs) { var self =this,conflictArray = []; var corPos; var j; //replaceSequenceByOption var oldSequence = $("#" + self._containerId + " ." + self._replaceSequenceClass).text(); if (!oldSequence) { oldSequence = $("#" + self._containerId + " ." + self.defaults.resultAreaClass + " .baseSequence").html(); } for ( j = 0; j < extraCopies + 1; j++) { if (j === 0) { corPos = pos; } else { corPos = corPos + (basePairs) + (seq.length); } if (self._callerObj._hasConfliction(seq, corPos, oldSequence)) { conflictArray.push(seq + "|" + corPos); } else { self._callerObj._replaceSequenceByOption("new", seq, corPos); } self._callerObj._handleConfliction(conflictArray); } //return out.join(""); }, isMotifViewExists : function(sequnce) { var rtn; if ($("#" + this._motifViewAreaId + "."+ sequnce).length > 0) { rtn = true; } else { rtn = false; } return rtn; }, _getMinPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod === 1) ? 1 : 0.5; return self._baseSequenceMinLength + Math.floor(seq.length / 2) + tHold; }, _getMaxPosition : function(seq) { var self = this; var mod = seq.length % 2; var tHold = (mod === 1) ? 0 : 0.5; return self._baseSequence.length - 1 - Math.floor(seq.length / 2) + tHold; }, _initPositionInsert : function(seq, pos) { return; /* var self = this; var mod = seq.length % 2; $("#" + self._motifViewAreaId + " .position").unbind("keyup"); $("#" + self._motifViewAreaId + " .position").keyup(function() { var val = $(this).val(); if (isNaN(val)) { $(this).val(pos); return; } var tmpVal = new String(Math.abs(val)); if (mod == 0) { if (tmpVal.indexOf(".") == -1) { $(this).val(tmpVal + ".5"); } else { $(this).val(tmpVal.split(".")[0] + ".5"); } } else { if (tmpVal.indexOf(".") > -1) { $(this).val(tmpVal.split(".")[0]); } } }); */ }, _initMotifSequenceListener : function() { var self = this; $("#" + self._containerId + " .motifSequence").click(function() { //$("." + self._options.motifViewDialogClass).hide(); var parent = $(this).closest('.userSequence'); var container = $(this).closest('.userSequence'); var seq = $(parent).find(".hdnSequence").val(); //var pos = $(parent).find(".hdnPosition").val(); var pos = $(parent).find(".hdnCorPosition").val(); var appropriatePos = 0; var seqEl = null; if (self._callerObj._getSeqElBySeq) { seqEl = self._callerObj._getSeqElBySeq(seq); appropriatePos = (seqEl && seqEl.getAppropriatePos()) ? seqEl.getAppropriatePos() : pos; } else { appropriatePos = pos; } if (self.isMotifViewExists(seq) === false) { self.drawMotifView(seq,appropriatePos); self._initSequencePopup(seqEl,seq); var dialogSelector = "#" + self._motifViewAreaId + "." + seq; $(dialogSelector + " ." + self.defaults.dialogErrorMessageClass).hide(); $(dialogSelector + " .sequence").val(seq); $(dialogSelector + " .position").val("-" + Math.abs(appropriatePos)); $(dialogSelector + " .extraCopies").val(0); $(dialogSelector + " .basePairs").val(0); $(dialogSelector + " .minSeq").html("-" + Math.abs(self._getMinPosition(seq))); $(dialogSelector + " .maxSeq").html("-" + Math.abs(self._getMaxPosition(seq))); self._initPositionInsert(seq, appropriatePos); $(dialogSelector).show(); } //$("#" + self._motifViewDialogId).dialog({title: self._default.motifViewDialogTitle + " - " + seq}); //$("#" + self._motifViewDialogId).dialog("open"); //$("#" + self._motifViewDialogId).closest('.' + self._options.motifViewDialogClass).show(); }); }, _initSequencePopup : function(seqEl,sequence) { var self = this; var dialogSelector = "#" + self._motifViewAreaId + "." + sequence; $(dialogSelector + " .moreInfo").unbind("click"); var url = (seqEl && seqEl.getExternalUrl()) ? seqEl.getExternalUrl() : "#"; if (url === "#") { $(dialogSelector + " .explink").html(" "); } else { $(dialogSelector + " .explink").show(); } $(dialogSelector + " .moreInfo").click(function() { self._callerObj._showPopupWindow(url); }); } }; Application.geneChart = function() { this._init.apply(this, arguments); }; Application.geneChart.prototype = { _containerId : null, _options : null, _workId : null, _fileName : null, _subject : null, _property : null, _highChartContainerId : null, _appProperty : null, _appName : null, _dataCollection : null, _chartBottomTitle : null, _geneLocus : null, _default : { filterNamespace : "http://linkdata.org/", acceptPropLabelPrefix : "label:", yAxisLabel : "Gene Expression Level", loadingImage : "http://app.linkdata.org/asset/67556085.gif", loadingText : "Loading Chart....", loadingMessageClass : "loadChartMessage", loadingChartContainerClass : "loadingChart", bottomLabelClass : 'bottomChartTitle' }, _init : function(containerId, options) { this._containerId = containerId; this._options = $.extend({}, this._default, options); this._workId = this._options.workId; this._fileName = this._options.fileName; this._subject = this._options.subject; this._property = this._options.property; var date = new Date(); this._highChartContainerId = "gene_chart_" + date.getTime(); this._initAppProperty(this._options); this._initView(); this._drawHighChart(this._subject, this._property); this._appName = this._options.appName; this._dataCollection = this._options.dataCollection; this._geneLocus = this._options.geneLocus; this._chartBottomTitle = "<div class='"+ this._default.bottomLabelClass +"'>Plot of gene expression levels for Gene " + this._geneLocus + " in the Collection " + this._dataCollection + ", found by "+ this._appName +". When replicate data is available, the upper and lower value will display as bars surrounding the data point.</div>" }, _initAppProperty : function(opts) { var obj = { workId : opts.workId, fileName : opts.fileName }; this._appProperty = new Application.motifProperty(obj); }, _initView : function() { var self = this; var sb = []; sb[sb.length] = "<div class='"+ this._default.loadingChartContainerClass +"' id='" + self._highChartContainerId + "'>"; sb[sb.length] = "<div class='"+ this._default.loadingMessageClass +"'>"+ this._default.loadingText +"</div>"; sb[sb.length] = "<div><img src='"+ this._default.loadingImage +"' /></div>"; sb[sb.length] = "</div>"; $("#" + self._containerId).html(sb.join("")); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _drawHighChart : function(subject, highlightProperty) { var self = this; var getDataArray = function(tripleList) { var dataArray = []; var dataObject = {}; var duplicateProperty = []; var equalIndex = 0; var madianArr = []; var errorArr = []; var valArr = []; var highLightColumnFound = false; // adding dummy object to the triple list. otherwise logic does not pick up the last values in 'valArr' var obj = { subject : 'subject', property : 'label:property', object : 'name' }; tripleList.push(obj); $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1 && property != "label:property") { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var val = parseFloat(tValue.object); var hLabel = self._getLabelAfterHash(highlightProperty); var propLabel = self._getLabelAfterHash(property); if (hLabel == propLabel) { highLightColumnFound = true; equalIndex++; } if ($.inArray(property, duplicateProperty) == -1 && duplicateProperty.length > 0) { var ele = self._getMadianCoordinate(valArr); if (ele != "") { if (highLightColumnFound && equalIndex > 1) { ele = self._getHighLightColumn(parseFloat(ele)); highLightColumnFound = false; equalIndex = 0; } madianArr.push(ele); } var arr = self._getErrorCoordinates(valArr); if (arr.length == 2) { errorArr.push([arr[0],arr[1]]); } valArr = []; valArr.push(val); } else { valArr.push(val); } duplicateProperty.push(property); } }); dataArray.push(self._getMadianGraphObj(madianArr,subject)); dataArray.push(self._getErrorGraphObj(errorArr)); self._getXCategory(tripleList, dataArray, highlightProperty); } LinkData.getTriplesBySubject(self._workId, self._fileName, subject, getDataArray); }, _getXCategory : function(tripleList, dataArray, highlightProperty) { var self = this; var array = []; var duplicateProperty = []; var hLabel = self._getLabelAfterHash(highlightProperty); var selectedProp = ""; $.each (tripleList, function(tKey, tValue) { var property = tValue.property; if (property.indexOf(self._options.filterNamespace) == -1) { return; } if ($.inArray(property, duplicateProperty) > -1) { return; } var label = self._getLabelAfterHash(property); if (!self._ignore(label)) { var displayLabel = self._getDisplayLabel(label); var hDisplayLabel = self._getDisplayLabel(hLabel); if (displayLabel === hDisplayLabel) { //displayLabel = "<span style=\"color:#FB3B44\">" + hDisplayLabel + "</span>"; selectedProp = displayLabel; } array.push(displayLabel); duplicateProperty.push(property); } }); self._drawChart(self._highChartContainerId, dataArray, array, selectedProp); }, _getMadianCoordinate : function(unsortedArray) { var sortedArr = this._getSortedArray(unsortedArray); var ele = ""; if (sortedArr.length == 3) { ele = sortedArr[1]; } else if (sortedArr.length > 0) { ele = sortedArr[0] } else { //alert("Plot value can only containes 3 values"); console.debug("error"); } return ele; }, _getErrorCoordinates : function(unsortedArray) { var sortedArr = this._getSortedArray(unsortedArray); var errorVals = []; if (this._isAllCoordinatesAreSame(sortedArr)) { return errorVals; } if (sortedArr.length == 3) { errorVals.push(sortedArr[0]); errorVals.push(sortedArr[2]); } else { //alert("Plot value can only containes 3 values"); console.debug("error"); } return errorVals; }, _isAllCoordinatesAreSame : function(arr) { if (arr.length == 1 || arr.length == 0) { return true; } for (var i = 0 ; i < arr.length ; i++){ if (i > 0 && arr[i] != arr[i-1]) { return false; } } return true; }, _getMadianGraphObj : function(values, subject) { var dataObject = {}; var toolTip = {}; toolTip.pointFormat = '<span style="font-weight: bold;">{series.name} [ {point.y} ]</span>'; dataObject.name = this._getLabel(subject); dataObject.data = values; //dataObject.type = 'spline'; dataObject.tooltip = toolTip; return dataObject; }, _getErrorGraphObj : function(values) { var dataObject = {}; var toolTip = {}; toolTip.pointFormat = '<br/><span style="color:#287A4B">(Replicate data points: from {point.low} to {point.high})</span><br/>'; dataObject.name = "errors"; dataObject.data = values; dataObject.type = 'errorbar'; dataObject.tooltip = toolTip; dataObject.stemColor = 'none'; dataObject.whiskerLength = 150; return dataObject; }, _getSortedArray : function(values) { var allMinus = false; values = this._getRequiredTriplicateValues(values); for (var index=0 ; index < values.length ; index++) { if (values[index] < 0) { allMinus = true; } else { allMinus = false; break; } } if (allMinus) { values.sort(function(a,b) { return b-a; }); } else { values.sort(function(a,b) { return a-b; }); } return values; }, _getRequiredTriplicateValues : function(unsortedVals) { var vals = []; if (unsortedVals.length > 3) { for (var i = 0 ; i < 3 ; i++) { vals[i] = unsortedVals[i]; } } else { return unsortedVals; } return vals; }, _getHighLightColumn : function(val) { var obj = {}; obj.y = val; obj.marker = { lineWidth: 3, lineColor: "#FB3B44", fillColor: "#FB3B78" }; return obj; }, _drawChart : function(containerId, dataArray, xCategory, selectedProp) { var self = this; var chart = new Highcharts.Chart({ chart: { renderTo: containerId, type: 'line', marginRight: 65, //130 marginBottom: 70, //125 zoomType: 'xy', reflow: false, events: { load: function(event) { $("#" + containerId).append(self._chartBottomTitle); } } }, title: { text: self._options.originalFileName }, xAxis: { categories: xCategory, labels : { rotation: 315, formatter: function () { if (selectedProp === this.value) { return '<span style="fill: red;">' + this.value + '</span>'; } else { return this.value; } } } }, yAxis: { title: { text: self._default.yAxisLabel } }, /*tooltip: { formatter: function() { return '<b>'+ this.series.name + '</b><br/>' + this.x + ' [' + this.y + ']'; } },*/ tooltip: { shared: true }, legend: { enabled: false /*layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0*/ }, series: dataArray }); self._scrollDown(); }, _scrollDown : function() { $("html, body").animate({ scrollTop: $(document).height() }, 1000); }, _getLabel : function(value) { var self = this, label; if (value.indexOf("#") > -1) { label = self._getLabelAfterHash(value); } else { label = self._appProperty.getGeneBySubject(value); } if (!label) { label = value; } return label; }, _getPropertyLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); propLabel = this._appProperty.getPropertyNameByLabel(propLabel); } return propLabel; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.motifProperty = function() { this._init.apply(this, arguments); }; Application.motifProperty.prototype = { _options : null, _propMap : null, _nameMap : null, _optionArray : null, _default : { acceptPropLabelPrefix : "label:", subjectATTEDUriPhrase : "http://atted.jp/data/locus/", subjectPPDBUriPhrase : "http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/display.cgi?organism=At&gene=", subjectTAIRUriPhrase : "http://arabidopsis.org/servlets/TairObject?type=locus&name=" }, _init : function(options) { this._options = $.extend({}, this._default, options); this._propMap = []; this._nameMap = []; this._initPropMap(this._options); }, _initPropMap : function(opts) { var self = this, workId = opts.workId, fileName = opts.fileName; var method = function(properties) { self._fillPropMap(self, properties); self._initOptionArray(properties); }; LinkData.getProperties(workId, fileName, method); }, _fillPropMap : function(self, properties) { $.each(properties, function(key, value) { var label = self._getLabel(value); if (!self._propMap[label]) { self._propMap[label] = value; } }); }, _initOptionArray : function(propertyList) { var self = this, list = {}; var workId = self._options.workId, fileName = self._options.fileName; self._optionArray = []; $.each(propertyList, function(key, value) { var propLabel = self._getLabel(value); if (!self._ignore(propLabel)) { var obj = {}; obj.key = propLabel; obj.value = self._getDisplayLabel(propLabel); self._optionArray.push(obj); } }); }, _ignore : function(label) { var self = this; if (label.indexOf(self._default.acceptPropLabelPrefix) > -1) { return false; } return true; }, _getDisplayLabel : function(value) { var self = this; var propLabel = value; var arr = value.split(self._default.acceptPropLabelPrefix); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, _getLabel : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; }, getOptionArray : function() { return this._optionArray; }, getPropertyByLabel : function(label) { return this._propMap[label]; }, getGeneBySubject : function(subject) { var self = this, htmlExt = ".html", geneLabel; if (subject.indexOf(self._default.subjectATTEDUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectATTEDUriPhrase, ""); } else if (subject.indexOf(self._default.subjectPPDBUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectPPDBUriPhrase, ""); } else if (subject.indexOf(self._default.subjectTAIRUriPhrase) > -1) { geneLabel = subject.replace(self._default.subjectTAIRUriPhrase, ""); } if (geneLabel && geneLabel.indexOf(htmlExt) > -1) { geneLabel = geneLabel.replace(htmlExt, ""); } return geneLabel; } }; Application.sequence = function() { this._init.apply(this, arguments); }; Application.sequence.prototype = { CHAR_SEQ_EMPTY : "-", _options : null, _workId : null, _fileName : null, _seqProperty : null, _posProperty : null, _baseSequence : null, _sequenceList : null, _positionList : null, _containerId : null, _errorContainerClass : null, _outOfRangeArray : null, _default : { msgInvalidSequence: "invalid sequence.", msgOutOfRangeSequence: "Some motifs fall outside the Promoter Design region of -50 to -550 base pairs : {0}" }, _init : function(options) { this._options = options; this._workId = this._options.workId; this._fileName = this._options.fileName; this._seqProperty = this._options.motifSequenceProperty; this._posProperty = this._options.motifPositionProperty; this._baseSequence = this._options.baseSequence; this._containerId = this._options.containerId; this._errorContainerClass = this._options.errorMessageClass; }, _getCustomSequenceHtml : function(baseSequence, sequence, position) { var seqLen = sequence.length; var tHold = Math.floor(seqLen / 2); var pos = parseInt(position, 10); var baseSeqLen = baseSequence.length; var suffixLen = baseSeqLen - (tHold + pos); var motifCorectedStartingPoint = position - (seqLen / 2); var sb = []; if (motifCorectedStartingPoint >= this._options.baseSequenceMinLength && suffixLen >= 0) { var i; for ( i = 0; i < suffixLen; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push("<a href='javascript:void(0)' class='motifSequence'>" + sequence + "</a>"); sb.push("<input type='hidden' class='hdnSequence' value='" + sequence + "'/>"); sb.push("<input type='hidden' class='hdnPosition' value='" + pos + "'/>"); sb.push("<input type='hidden' class='hdnCorPosition' value='-" + position + "'/>"); } else { //_showError($appContainer, opts.msgOutOfRangeSequence.replace("{0}", sequence)); this._outOfRangeArray.push(sequence + "[-" + position + "]"); this._showError(this._default.msgOutOfRangeSequence.replace("{0}", this._outOfRangeArray.join(", "))); } return sb.join(""); }, _isValidSequenceList : function(seqs) { var count = seqs.length; var maxlength = 0; var i; for ( i = 0; i < count; i++) { if (seqs[i].length > maxlength) { maxlength = seqs[i].length; } } var result = true; for ( i = 0; i < maxlength; i++) { var chars = []; var j; for ( j = 0; j < count; j++) { chars.push(seqs[j].charAt(i)); } if (! this._isValidChars(chars.join(""))) { result = false; break; } } return result; }, _isValidBaseReplacementMotif : function(baseSequence, seqs) { var self = this; var mergeSequence = this._getMergeCharSequence(seqs); var length = baseSequence.length; var i; for ( i = 0; i < length; i++) { var bChar = baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY && bChar !== this.CHAR_SEQ_EMPTY && mChar !== bChar) { return false; } } return true; }, _isValidChars : function(charString) { var charLen = charString.length; var result = true; var first = null; var i; for ( i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { if (! first) { first = charString.charAt(i); } var current = charString.charAt(i); if (current && first !== current) { result = false; break; } } } return result; }, _getReplacedCustomSequence : function(seqs) { var mergeSequence = this._getMergeCharSequence(seqs); var maxlength = this._baseSequence.length; var sb = []; var i; for ( i = 0; i < maxlength; i++) { var bChar = this._baseSequence.charAt(i); var mChar = mergeSequence.charAt(i); if (mChar !== this.CHAR_SEQ_EMPTY) { // replaced sb.push(mChar); } else { sb.push(bChar); } } return sb.join(""); }, _getMergeCharSequence : function(seqs) { var count = seqs.length; var maxlength = this._baseSequence.length; var sb = []; var i; for ( i = 0; i < maxlength; i++) { var chars = []; var j; for (j = 0; j < count; j++) { chars.push( seqs[j].charAt(i) || this.CHAR_SEQ_EMPTY ); } sb.push(this._getMergeChar(chars.join(""))); } return sb.join(""); }, _getMergeChar : function(charString) { var charLen = charString.length; var result = null; var i; for (i = 0; i < charLen; i++) { if (charString.charAt(i) !== this.CHAR_SEQ_EMPTY) { result = charString.charAt(i); break; } } if (!result) { result = this.CHAR_SEQ_EMPTY; } return result; }, _wrappedReplacedSequenceHtml : function(replaceSequence, seqs) { var self = this, sb = []; var mergeSequence = this._getMergeCharSequence(seqs); var length = this._baseSequence.length; var i; for (i = 0; i < length; i++) { var bChar = this._baseSequence.charAt(i); var rChar = replaceSequence.charAt(i); var mChar = mergeSequence.charAt(i); var seqChar = (bChar !== rChar) ? "<span class='replace'>" + rChar + "</span>" : rChar; if (mChar !== this.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(seqChar); } } return sb.join(""); }, /* _getSequenceAndPositionHiddenHtml : function(seqArray, posArray) { var self = this, sb = []; if (!seqArray || !posArray) { return sb.join(""); } for (var i = 0; i < seqArray.length; i++) { sb[sb.length] = "<input type='hidden' class='hdnReplacedMotif' value='" + seqArray[i] + "|" + posArray[i] + "'/>"; } return sb.join(""); }, */ _showError : function(message) { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass); $errorMessageContainer.html(message); $errorMessageContainer.show(); }, getHtmlByReplacingOldSequence : function(oldSequence, newSequence) { var self = this, sb = []; var i; for (i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); var seqChar = (oChar !== nChar) ? "<span class='replace'>" + oChar + "</span>" : oChar; if (nChar !== self.CHAR_SEQ_EMPTY) { if (oChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(nChar); } } else { sb.push(oChar); } } return sb.join(""); }, getHtmlByReplacingNewSequence : function(oldSequence, newSequence) { var self = this, sb = []; var i; for ( i = 0; i < oldSequence.length; i++) { var oChar = oldSequence.charAt(i); var nChar = newSequence.charAt(i); var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence'>" + seqChar + "</span>"); } else { sb.push(oChar); } } return sb.join(""); }, getSequenceHtml : function(subject, drawSequence) { var self = this; self._outOfRangeArray = []; var sb = [], baseSequence = self._baseSequence; var getTriplesBySequenceProperty = function(sequenceList) { self._getTriplesBySequenceProperty(subject, drawSequence, sequenceList); }; LinkData.getObjects(self._workId, self._fileName, subject, self._seqProperty, getTriplesBySequenceProperty); }, _getTriplesBySequenceProperty : function(subject, drawSequence, sequenceList) { var self = this; var getTriplesByPositionProperty = function(positionList) { self._drawSequenceList(drawSequence, sequenceList, positionList); }; LinkData.getObjects(self._workId, self._fileName, subject, self._posProperty, getTriplesByPositionProperty); }, _drawSequenceList : function(drawSequence, sequenceList, positionList) { var self = this, sb = []; var i; if (!sequenceList || sequenceList.length === 0) { return; } for (i = 0; i < sequenceList.length; i++) { var customSeqString = self._getCustomSequenceHtml(self._baseSequence, sequenceList[i], positionList[i]); if (customSeqString.length > 0) { sb.push("<div>"); sb.push("<div class='userSequence'>" + customSeqString + "</div>"); //sb.push(" <span class='deletelink "+ sequenceList[i] +"' onclick='self._deleteUserSequence("+ """ + sequenceList[i] + """ +","+ """ + self._containerId + """ +");'>"); sb.push(" <span class='deletelink "+ sequenceList[i] +"'>"); sb.push("<img src='http://app.linkdata.org/asset/c6bf2a0f.png' title='Delete' /></span>"); //sb.push("<div> </div>"); sb.push("</div>"); } } sb.push("<div> </div>"); drawSequence(sb.join("\n")); self._attachDeleteEvent(); }, _attachDeleteEvent : function () { var self = this; var timer = new Application.timer(); var attachEvent = function() { var length = $("#" + self._containerId + " .deletelink").length; if (length > 0) { $("#" + self._containerId + " .deletelink").unbind("click"); $("#" + self._containerId + " .deletelink").click(function() { var parent = $(this).parent(); $(parent).remove(); }); } else { timer.call(attachEvent); } } attachEvent(); }, getFormattedSequence : function(baseSeqLen, seq, pos) { var self = this, sb = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2); pos = parseInt(pos, 10); var len = baseSeqLen - (tHold + pos); var i; for ( i = 0; i < len; i++) { sb[sb.length] = self.CHAR_SEQ_EMPTY; } sb[sb.length] = seq; return sb.join(""); }, replace : function(seqs, seqArray, posArray) { var self = this, isValid = self._isValidSequenceList(seqs); if (isValid) { if (seqs.length > 0) { var sb = []; var replaceSeq = self._getReplacedCustomSequence(seqs); sb[sb.length] = self._wrappedReplacedSequenceHtml(replaceSeq, seqs); //sb[sb.length] = self._getSequenceAndPositionHiddenHtml(seqArray, posArray); return sb.join(""); } } else { this._showError(self._default.msgInvalidSequence); } }, replaceWith : function(seq, pos, extraCopies, basePairs) { var main = [], seqArray = [], posArray = [], conflictArray = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2); pos = parseInt(pos, 10); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - (tHold + pos); var corPos; var j; seqArray.push(seq); posArray.push(pos); for (j = 0; j < extraCopies + 1; j++) { var i; var array = []; for ( i = 0; i < len; i++) { array.push(this.CHAR_SEQ_EMPTY); } array.push(seq); main.push(array.join("")); len = len - seqLen - basePairs; if (len < 0) { break; } } //return this.replace(main, seqArray, posArray); return main; }, getReplacingSeq : function(seq,pos) { var sb = [], out = []; var seqLen = seq.length; var tHold = Math.floor(seqLen / 2); pos = parseInt(pos, 10); var baseSeqLen = this._baseSequence.length; var len = baseSeqLen - (tHold + pos); var i; for ( i = 0; i < len; i++) { sb.push(this.CHAR_SEQ_EMPTY); } sb.push(seq); return sb.join(""); }, getReColoredMotifViewSequnce : function(seq, pos, extraCopies, basePairs, replaceDivClass) { var self = this; var sb = []; var seqs = self.replaceWith(seq, pos, extraCopies, basePairs); var replaceSeq = self._getReplacedCustomSequence(seqs); var existingSequence = $("#" + self._containerId + " ." + replaceDivClass).text(); var repSeqLen = replaceSeq.length; var index; for ( index = 0 ; index < repSeqLen ; index++) { var oChar = existingSequence.charAt(index); var nChar = replaceSeq.charAt(index); //var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (index < (repSeqLen - 50)) { if (nChar === oChar && nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence replace'>" + nChar + "</span>"); } else { sb.push(oChar); } } else { sb.push(oChar); } } //self._doReplaceWithHtml(sb.join("")); return sb.join(""); }, /* hideError : function() {Seq.charAt(index); //var seqChar = (oChar !== nChar) ? "<span class='replace'>" + nChar + "</span>" : nChar; if (index < (exisSeqLen - 50)) { if (nChar == oChar && nChar !== self.CHAR_SEQ_EMPTY) { sb.push("<span class='highlight-sequence replace'>" + nChar + "</span>"); } else { sb.push(oChar); } } else { sb.push(oChar); } } //self._doReplaceWithHtml(sb.join("")); return sb,join(""); },*/ hideError : function() { $errorMessageContainer = $("#" + this._containerId + " ." + this._errorContainerClass).hide(); } }; Application.heptamer = function() { this._init.apply(this, arguments); }; Application.heptamer.prototype = { _heptamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { heptamerTag : "heptamer", filterSequencePropertyPhrase : "motif_sequence", filterMaxCEGPropertyPhrase : "maxCEG", //filterAppropriatePosition : "Appropriateposition(%C2%B1%2040%20bp)" filterAppropriatePosition : "Appropriateposition%28%C2%B1%2040%20bp%29" }, _init : function() { this._heptamerMap = []; this._initHeptamerList(); }, _initHeptamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initHeptamer(workId, fileName); return false; }); }); }; LinkData.getFilesByTag(null, self._default.heptamerTag, getFilesByTag); }, _initHeptamer : function(workId, fileName) { var self = this; var getPropertyList = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); }; LinkData.getProperties(workId, fileName, getPropertyList); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillHeptamerMap(workId, fileName, sequenceTripleList); }; LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillHeptamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { var i; for (i = 0; i < sequenceTripleList.length; i++) { var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[i]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._heptamerMap[seqTriple.object] = seqEl; } }; LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._heptamerMap[sequence]; } }; Application.octamer = function() { this._init.apply(this, arguments); }; Application.octamer.prototype = { _octamerMap : null, _motifSequenceProperty : null, _appropriatePositionProperty : null, _default : { octamerTag : "octamer", filterSequencePropertyPhrase : "sequence", filterAppropriatePosition : "Appropriate%20position" }, _init : function() { this._octamerMap = []; this._initOctamerList(); }, _initOctamerList : function() { var self = this; var getFilesByTag = function(result) { $.each(result, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._initOctamer(workId, fileName); return false; }); }); }; LinkData.getFilesByTag(null, self._default.octamerTag, getFilesByTag); }, _initOctamer : function(workId, fileName) { var self = this; var getProperties = function(propertyList) { self._initProperty(propertyList); self._getSequenceTriple(workId, fileName); }; LinkData.getProperties(workId, fileName, getProperties); }, _initProperty : function(propertyList) { var self = this; $.each(propertyList, function(propKey, propValue) { if (propValue.indexOf(self._default.filterSequencePropertyPhrase) > -1) { self._motifSequenceProperty = propValue; } else if (propValue.indexOf(self._default.filterAppropriatePosition) > -1) { self._appropriatePositionProperty = propValue; } }); }, _getSequenceTriple : function(workId, fileName) { var self = this; var getSequenceTripleList = function(sequenceTripleList) { self._fillOctamerMap(workId, fileName, sequenceTripleList); }; LinkData.getTriplesByProperty(workId, fileName, self._motifSequenceProperty, getSequenceTripleList); }, _fillOctamerMap : function(workId, fileName, sequenceTripleList) { var self = this; var getPositionTripleList = function(positionTripleList) { var i; for ( i = 0; i < sequenceTripleList.length; i++) { var j = Math.floor(i / 2); var seqTriple = sequenceTripleList[i]; var posTriple = positionTripleList[j]; var seqEl = new Application.seqElement(); seqEl.setExternalUrl(seqTriple.subject); seqEl.setSequence(seqTriple.object); seqEl.setAppropriatePos(posTriple.object); self._octamerMap[seqTriple.object] = seqEl; } }; LinkData.getTriplesByProperty(workId, fileName, self._appropriatePositionProperty, getPositionTripleList); }, getBySequence : function(sequence) { return this._octamerMap[sequence]; } }; Application.seqElement = function() { this._init.apply(this, arguments); }; Application.seqElement.prototype = { _externalUrl : null, _sequence : null, _appropriatePos : null, _init : function() {}, getExternalUrl : function() { return this._externalUrl; }, setExternalUrl : function(externalUrl) { this._externalUrl = externalUrl; }, getSequence : function() { return this._sequence; }, setSequence : function(sequence) { this._sequence = sequence; }, getAppropriatePos : function() { return this._appropriatePos; }, setAppropriatePos : function(appropriatePos) { this._appropriatePos = appropriatePos; } }; Application.timer = function() { this._init.apply(this, arguments); }; Application.timer.prototype = { _delay : null, _retry : null, _maxRetry : null, _init : function() { this._delay = 1000; this._retry = 0; this._maxRetry = 100; }, call : function(func) { if (this._retry < this._maxRetry) { setTimeout(func, this._delay); } this._retry++; }, setMaxRetryCount : function(no) { this._maxRetry = no; } }; Application.index = function() { this._init.apply(this, arguments); }; Application.index.prototype = { _start : null, _end : null, _init : function(start, end) { this._start = start; this._end = end; }, getIndex : function() { return {start : this._start, end : this._end}; }, getItemCount : function() { return (this._end - this._start + 1); }, increment : function() { var itemCount = this.getItemCount(); this._start = this._start + itemCount; this._end = this._end + itemCount; return {start : this._start, end : this._end}; }, getStartIndex : function() { return this._start; }, getEndIndex : function() { return this._end; } }; Application.tooltip = function() { this._init.apply(this, arguments); }; Application.tooltip.prototype = { _toolTipList : null, _default : { explanationProperty : "explanation" }, _init : function() { this._toolTipList = []; this._initToolTip(); }, _initToolTip : function() { var self = this; var getFilesByTag = function(resultList) { $.each(resultList, function(workId, fileList) { $.each(fileList, function(fileKey, fileName) { self._getFilePropertyList(workId, fileName); return false; }); }); }; LinkData.getFilesByTag(null, "tooltip", getFilesByTag); }, _getFilePropertyList : function(workId, fileName) { var self = this; var index = new Application.index(1, 10000); var getProperties = function(propertyList) { $.each(propertyList, function(pKey, pValue) { if (pValue.indexOf(self._default.explanationProperty) > -1) { self._getSubjectList(workId, fileName, pValue, index); return false; } }); }; LinkData.getProperties(workId, fileName, getProperties); }, _getSubjectList : function(workId, fileName, property, index) { var self = this; var getSubjects = function(subjectList) { self._getPropertyList(subjectList, workId, fileName, property, index); }; LinkData.getSubjects(workId, fileName, getSubjects, index); }, _getPropertyList : function(subjectList, workId, fileName, property, index) { var self = this; var getTriplesByProperty = function(tripleList) { self._addToolTipToList(subjectList, tripleList, workId, fileName, property, index); }; LinkData.getTriplesByProperty(workId, fileName, property, getTriplesByProperty, index); }, _addToolTipToList : function(subjectList, tripleList, workId, fileName, property, index) { var self = this; var i; for ( i = 0; i < subjectList.length; i++) { var key = self._getLabelAfterHash(subjectList[i]); if (tripleList[i]) { var value = tripleList[i].object; self._addToolTip(key, value); } } if (subjectList && subjectList.length === index.getItemCount()) { self._getSubjectList(workId, fileName, property, index.increment()); } }, _addToolTip : function(key, tooltip) { var obj = {}; obj.key = key; obj.tooltip = tooltip; this._toolTipList.push(obj); }, getByKey : function(key) { var self = this, tooltip; $.each(self._toolTipList, function(objKey, obj) { if (obj.key.toString().toLowerCase() === key.toString().toLowerCase()) { tooltip = obj.tooltip; return false; } }); return tooltip || ""; }, _getLabelAfterHash : function(value) { var propLabel = value; var arr = value.split("#"); if (arr.length > 1) { propLabel = decodeURIComponent(arr[1]); } return propLabel; } }; Application.externalLink = function(toolName) { this._init.apply(this, arguments); }; Application.externalLink.prototype = { _externalLinksTriples : [], _toolName : null, _default : { externalLinkTag : "external_links" }, _props : { toolList : "tool%20list", category : "category", url : "url", geneCase : "gene%20case", upperCase : "U", lowerCase : "L" }, _init : function(toolName) { this._toolName = toolName; this._loadExtrnalLinksFile(); }, // reading the whole external links file as triple objects _loadExtrnalLinksFile : function() { var self = this; var findExtarnlLinkFile = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { self._loadFileTriples(wId,fName); }); }); }; LinkData.getFilesByTag(null, this._default.externalLinkTag, findExtarnlLinkFile); }, _loadFileTriples : function(workId,fileName) { var self = this; var loadTriples = function(results) { self._externalLinksTriples = results; self._filterTriplesByToolName(results); }; LinkData.getTriples(workId,fileName,loadTriples,{start:1, end:100}); }, _filterTriplesByToolName : function(linkTriples) { var filtredList = []; for (var index = 0 ; index < linkTriples.length ; index++) { var triple = linkTriples[index]; var prop = this._getProperty(triple.property); if (prop == this._props.toolList) { var toolNames = triple.object.split(","); for (var i = 0 ; i < toolNames.length ; i++) { var toolName = toolNames[i].trim(); if (toolName.toLowerCase() == this._toolName.toLowerCase()) { var triplesBySubject = this._getTriplesBySubject(triple.subject); for (var j = 0 ; j < triplesBySubject.length ; j++) { var otherTriple = triplesBySubject[j]; filtredList.push(otherTriple); } break; } } } } this._externalLinksTriples = filtredList; }, _getDistinctCategories : function() { var distinctCategoryNames = this._getDistinctStringList(this._props.category,this._externalLinksTriples); return distinctCategoryNames; }, _getExternalLinksForCategory : function(categoryName) { var extLinks = []; var geneCase,url; var triplesByPropVal = this._getTriplesByPropertyValue(this._props.category,categoryName); for (var index = 0 ; index < triplesByPropVal.length ; index++) { var triple = triplesByPropVal[index]; var subject = triple.subject; var triples = this._getTriplesBySubject(subject); for (var i = 0 ; i < triples.length ; i++) { var linkTriple = triples[i]; var prop = this._getProperty(linkTriple.property).trim(); if (prop.toLowerCase() == this._props.geneCase) { geneCase = linkTriple.object; } else if (prop.toLowerCase() == this._props.url) { url = linkTriple.object; } if (url && geneCase) { var linkName = linkTriple.subject.split("#")[1]; var obj = { linkName : linkName, geneCase : geneCase, url : url } extLinks.push(obj); url = null; geneCase = null; break; } } } return extLinks; }, _getTriplesBySubject : function(subject) { var filteredList = []; var currentList = this._externalLinksTriples; for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var triSubject = triple.subject; if (triSubject.trim() == subject.trim()) { filteredList.push(triple); } } return filteredList; }, _getProperty : function(propertyUrl) { var comps = propertyUrl.split("#"); return comps[comps.length-1]; }, _getTriplesByPropertyValue : function(propName,value) { /* this function first will find the triple with the passed property and then this will take the subject of it and will find other properties of that subject */ var filteredList = []; for (var index = 0 ; index < this._externalLinksTriples.length ; index++) { var triple = this._externalLinksTriples[index]; var prop = this._getProperty(triple.property); if (prop.toLowerCase() == propName.toLowerCase()) { var propVal = triple.object; if (propVal.trim() == value.trim()) { filteredList.push(triple); //break; } } } return filteredList; }, // returns a string array _getDistinctStringList : function(propName,tripleList) { var distinctList = []; for (var index = 0 ; index < tripleList.length ; index++) { var triple = tripleList[index]; var prop = this._getProperty(triple.property); if (prop && prop.toLowerCase() == propName.toLowerCase()) { var objVal = triple.object; if (distinctList.indexOf(objVal) == -1) { distinctList.push(objVal); } } } return distinctList; }, }; Application.DbHandler = function() { this._init.apply(this,arguments); } Application.DbHandler.prototype = { _fullList : [], _properties : { motifAnalysisMethod : "motif%20analysis%20method", geneExpressionData : "gene%20expression%20data", menuDisplayName : "menu%20display%20name", toolsList : "tool%20list", workIdInTest : "test.linkdata.org", workIdPublic : "linkdata.org", ranklistWorkIdTest : "rank%20list%20test.linkdata.org", ranklistWorkIdPublic : "rank%20list%20linkdata.org" }, _tags : { menuDataSourceTag : "menu" }, _defaults : { linkdataTestUrl : "test.linkdata.org", linkdataPublicUrl : "linkdata.org", }, _init : function(args) { this._initMenuDataSource(); }, _fillFileProperties : function() { var self = this; var setProperties = function(props) { self._fileProperties = props; }; LinkData.getProperties(this._workId,this._fileName,setProperties); }, _initMenuDataSource : function() { var self = this; var foundMenuFiles = []; var loadMenuFiles = function(resultList) { $.each(resultList, function(wId, fileList) { $.each(fileList, function(fileKey, fName) { var obj = { workId : wId, fileName : fName }; foundMenuFiles.push(obj); }); }); self._foundMenuFiles = foundMenuFiles; self._loadMenuFileContent(foundMenuFiles); self._fillFileProperties(); }; LinkData.getFilesByTag(null, this._tags.menuDataSourceTag, loadMenuFiles); }, _loadMenuFileContent : function(menuFiles) { var self = this; var addFileContent = function(triples) { self._fullList = triples; }; if (menuFiles.length > 1) { alert("There can be only one file that can be tagged with 'menu'"); return; } if (menuFiles.length == 0) { return; } var obj = menuFiles.shift(); // removing the first element this._fileName = obj.fileName; this._workId = obj.workId; LinkData.getTriples(this._workId,this._fileName,addFileContent,{start:1, end:2000}); }, _getDataCollectionNameByDbName : function(dbName) { var dataCollection = null; if (!(this._fullList)) return null; for (var index = 0 ; index < this._fullList.length ; index++) { var triple = this._fullList[index]; var dbOnlyPart = triple.subject.split("#")[1]; if (dbOnlyPart.toLowerCase().trim() == dbName.toLowerCase().trim()) { var prop = this._getProperty(triple.property); if (prop.trim().toLowerCase() == this._properties.menuDisplayName.toLowerCase()) { dataCollection = triple.object; break; } } } return dataCollection; }, _getDistinctDbNamesByToolName : function(toolName) { var self = this; if (!(toolName)) return self._fullList; if (!(this._fullList)) return null; var listByTool = self._getTriplesByProperty(this._properties.toolsList,self._fullList); if (!listByTool) return null; var dbInfoObjs = []; for (var index = 0 ; index < listByTool.length ; index++) { var triple = listByTool[index]; if (triple.object) { var toolList = triple.object.split(","); for (var index1 = 0 ; index1 < toolList.length ; index1++) { var tool = toolList[index1]; if (tool.trim() == toolName.trim()) { var subject = triple.subject; var otherPropTripleList = self._getTriplesBySubject(subject); var obj = self._getDbInfoObject(otherPropTripleList); dbInfoObjs.push(obj); break; } } } } return dbInfoObjs; }, _getDbInfoObject : function(triplesListForSubject) { var workId, fileName, dataColl = null, analysisMethod = null, rankListId = null; for (var index1 = 0 ; index1 < triplesListForSubject.length ; index1++) { var triple = triplesListForSubject[index1]; var property = this._getProperty(triple.property); var workIdProp = this._getWorkIdProperty(); var rankWorkIdProp = this._getRankingWorkIdProperty(); var analysisMethodProp = this._getProperty(triple.property); if (property.trim().toLowerCase() == workIdProp.trim().toLowerCase()) { var workIdComps = triple.object.toString().split("/"); workId = workIdComps[workIdComps.length-1]; } if (property.trim().toLowerCase() == this._properties.menuDisplayName.trim().toLowerCase()) { dataColl = triple.object; } if (property.trim().toLowerCase() == this._properties.motifAnalysisMethod.trim().toLowerCase()) { analysisMethod = triple.object; } if (property.trim().toLowerCase() == rankWorkIdProp.trim().toLowerCase()) { var rankListIdComps = triple.object.toString().split("/"); rankListId = rankListIdComps[rankListIdComps.length-1]; } if (workId && dataColl && analysisMethod && rankListId) { fileName = triple.subject.split("#")[1]; break; } } var obj = { fileName : fileName, workId : workId, dataColl : dataColl, analysisMethod : analysisMethod, rankListWorkId : rankListId, }; return obj; }, _getProperty : function(propertyUrl) { var comps = propertyUrl.split("#"); return comps[comps.length-1]; }, _getWorkIdProperty : function() { var hostName = window.location.hostname; if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) { return this._properties.workIdInTest; } else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) { return this._properties.workIdPublic; } }, _getTriplesByProperty : function(propName,currentList) { var filteredList = []; for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var prop = this._getProperty(triple.property); if (prop == propName) { filteredList.push(triple); } } return filteredList; }, _getTriplesBySubject : function(subject) { var filteredList = []; for (var index = 0 ; index < this._fullList.length ; index++) { var triple = this._fullList[index]; var triSubject = triple.subject; if (triSubject.trim() == subject.trim()) { filteredList.push(triple); } if (filteredList.length == this._fileProperties.length) { break; } } return filteredList; }, // returns a string array _getDistinctObjectList : function(propName,currentList) { var distinctList = []; for (var index = 0 ; index < currentList.length ; index++) { var triple = currentList[index]; var prop = triple.property; if (prop && prop.indexOf(propName) != -1) { var objVal = triple.object; if (distinctList.indexOf(objVal) == -1) { distinctList.push(objVal); } } } return distinctList; }, _getRankingWorkIdProperty : function() { var hostName = window.location.hostname; if (hostName.indexOf(this._defaults.linkdataTestUrl) != -1) { return this._properties.ranklistWorkIdTest; } else if (hostName.indexOf(this._defaults.linkdataPublicUrl) != -1) { return this._properties.ranklistWorkIdPublic; } }, } $(document).ready(function() { var dbHandler = new Application.DbHandler(); var timer = new Application.timer(); var fillDatabase = function(resultList) { var dbNames = dbHandler._getDistinctDbNamesByToolName("MotifRanking"); if (dbNames && dbNames.length > 0) { $(".motifMaxDatabase").append("<option value='-1' selected='selected'>-- Select Database --</option>"); for (var index = 0 ; index < dbNames.length ; index++) { var obj = dbNames[index]; $(".motifMaxDatabase").append("<option value='" + obj.workId + "|" + obj.fileName + "|" + obj.dataColl + "|" + obj.rankListWorkId + "'>" + obj.fileName + "</option>"); } var execute = function(dbKey) { if (dbKey === -1) { $("#container").html(""); return; } var array = dbKey.split("|"); var containerId = "container"; var options = { workId : array[0], fileName : array[1], rankListWorkId : array[3], baseSequence : "--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG", fixedSequence : "GATCCCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG", dataColl : array[2] }; var app = new Application.motifRanking(containerId, options); }; $(".motifMaxDatabase").change(function() { var dbKey = $("option:selected", $(this)).val(); execute(dbKey); }); }else { timer.call(fillDatabase); } }; LinkData.getFilesByTag(null, "database", fillDatabase); });
body { font-family: sans-serif; font-size: 14px; } a { color: #3B5998; font-weight: bold; text-decoration: none; } .hidden { display:none; } .left { float: left; } .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; min-width: 125px; } .row { padding: 5px 0; } .row:after { content: ""; clear: left; display: block; } .row input[type="text"] { width: 200px; } .row .externalLink { margin: 0 5px; } .highlight-sequence { font-weight: bold; } .resultArea .userSequence { white-space: nowrap; float: left; } .resultArea { font-family: "Courier New","Lucida Console"; margin: 10px 0; min-width: 410px; overflow: auto; width: 100%; background-color: #FFFFFF; border: 1px solid #DDDDDD; white-space: nowrap; } .replaceSequence { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; width: 100%; overflow: auto; white-space: nowrap; } .wrappedSequenceMotif { background-color: #FFFFFF; border: 1px solid #DDDDDD; margin: 10px 0 0; font-family: "Courier New","Lucida Console"; overflow: auto; word-wrap: break-word; /*white-space: nowrap;*/ width:100%; height:90px; word-break: break-all; } .replace { color: #E80010; } .errorMessage { /*color: #FF0000;*/ /*text-align: center;*/ margin-bottom: -10px; margin-top: 10px; } .databaseInfo .motif { width: 70%; } /** * button css */ .actionBtn { border: 1px solid #DDDDDD; cursor: pointer; display: inline-block; font-weight: bold; padding: 5px 2px; text-align: center; width: 25px; } .actionBtn:hover { border: 1px solid #000000; } .btn { display: inline-block; *display: inline; /* IE7 inline-block hack */ *zoom: 1; padding: 4px 10px 4px; margin-bottom: 0; font-size: 13px; line-height: 18px; color: #333333; text-align: center; text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75); vertical-align: middle; background-color: #f5f5f5; background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6); background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6)); background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6); background-image: -o-linear-gradient(top, #ffffff, #e6e6e6); background-image: linear-gradient(top, #ffffff, #e6e6e6); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0); border-color: #e6e6e6 #e6e6e6 #bfbfbf; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); border: 1px solid #cccccc; border-bottom-color: #b3b3b3; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; -webkit-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); -moz-box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); box-shadow: inset 0 1px 0 rgba(255, 255, 255, 0.2), 0 1px 2px rgba(0, 0, 0, 0.05); cursor: pointer; *margin-left: .3em; } .btn:hover, .btn:active, .btn.active, .btn.disabled, .btn[disabled] { background-color: #e6e6e6; } .btn:hover { color: #333333; text-decoration: none; background-color: #e6e6e6; background-position: 0 -15px; -webkit-transition: background-position 0.1s linear; -moz-transition: background-position 0.1s linear; -ms-transition: background-position 0.1s linear; -o-transition: background-position 0.1s linear; transition: background-position 0.1s linear; } .btn-blue, .btn-blue:hover, .btn-yellow, .btn-yellow:hover, .btn-red, .btn-red:hover, .btn-green, .btn-green:hover, .btn-lightblue, .btn-lightblue:hover, .btn-black, .btn-black:hover { text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25); color: #ffffff; } .btn-blue { background-color: #0074cc; background-image: -moz-linear-gradient(top, #0088cc, #0055cc); background-image: -ms-linear-gradient(top, #0088cc, #0055cc); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc)); background-image: -webkit-linear-gradient(top, #0088cc, #0055cc); background-image: -o-linear-gradient(top, #0088cc, #0055cc); background-image: linear-gradient(top, #0088cc, #0055cc); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0); border-color: #0055cc #0055cc #003580; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-blue:hover, .btn-blue:active, .btn-blue.active, .btn-blue.disabled, .btn-blue[disabled] { background-color: #0055cc; } .btn-green { background-color: #5bb75b; background-image: -moz-linear-gradient(top, #62c462, #51a351); background-image: -ms-linear-gradient(top, #62c462, #51a351); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351)); background-image: -webkit-linear-gradient(top, #62c462, #51a351); background-image: -o-linear-gradient(top, #62c462, #51a351); background-image: linear-gradient(top, #62c462, #51a351); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0); border-color: #51a351 #51a351 #387038; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-green:hover, .btn-green:active, .btn-green.active, .btn-green.disabled, .btn-green[disabled] { background-color: #51a351; } .btn-green:active, .btn-green.active { background-color: #408140 ¥9; } .btn-lightblue { background-color: #49afcd; background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4); background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4); background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4)); background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4); background-image: -o-linear-gradient(top, #5bc0de, #2f96b4); background-image: linear-gradient(top, #5bc0de, #2f96b4); background-repeat: repeat-x; filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0); border-color: #2f96b4 #2f96b4 #1f6377; border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25); filter: progid:dximagetransform.microsoft.gradient(enabled=false); } .btn-lightblue:hover, .btn-lightblue:active, .btn-lightblue.active, .btn-lightblue.disabled, .btn-lightblue[disabled] { background-color: #2f96b4; } /* Dialog css */ .motifViewDialog .explanation { color: #AAAAAA; font-size: 12px; margin-left : 200px; margin-top : -10px; } .motifViewDialog .moreInfo { color: #3B5998; cursor: pointer; } .motifViewDialog .basePairs, .motifViewDialog .extraCopies, .motifViewDialog .position { width: 70px; } .motifViewDialog .dialogErrorMessage { font-size: 12px; } .ui-corner-all, .ui-corner-top, .ui-corner-left, .ui-corner-tl { border-top-left-radius: 1px; } .ui-corner-all, .ui-corner-top, .ui-corner-right, .ui-corner-tr { border-top-right-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-left, .ui-corner-bl { border-bottom-left-radius: 1px; } .ui-corner-all, .ui-corner-bottom, .ui-corner-right, .ui-corner-br { border-bottom-right-radius: 1px; } .loadingImageContainer .loadingMessage { color: #FF0000; } .motifConflictionDialog .option { margin: 10px; } .motifViewDialog { margin-top: 10px; } .motifViewDialog .label { color: #E87B10; font: 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; height: 24px; width : 200px; } .motifViewDialog .motifviewinfo { float: right; margin-top: -150px; position: relative; width: 350px; } .deletelink { cursor: pointer; } .deletelink img { margin-bottom: -3px; } .fixedSequenceMotif { display: inline; float: right; font-family: "Courier New","Lucida Console"; margin-top: -15px; } .resultAreaUserMessageClass { color: #0A5DA6; font: bold 1.1em "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; font-size: 12px; font-weight: bold; margin-top: -6px; margin-bottom: 4px; } .motifviewsequence { float: right; height: 40px; overflow: auto; width: 240px; margin-bottom: 5px; } .deletelink { cursor: pointer; } .deletelink img { margin-bottom: -3px; } .bottomChartTitle { color: #0A5DA6; font: bold 12px "Trebuchet MS","Helvetica","Arial","Verdana","sans-serif"; }
<div class="row"> <div class="label left">Select Database</div> <div class="left"><select class="motifMaxDatabase"></select></div> </div> <div class="row hidden"> <div class="label left">Application Option</div> <div class="left"> <input type="radio" name="option" value="max" checked="checked"/> max <input type="radio" name="option" value="min"/> min </div> </div> <div id="container"></div>
Preview
Input Data
ReadMe
Snapshots
LinkData Work
Table Data
Rank Lists of AtGenExpress ATTED
Contributor:Koro_Nishikata
Update:Apr 22, 2013
240 Downloads, 16 Applications
Lists for the expression of AtGenExpress and ATTED-II mashup data table. For each experiment, all genes ranked by expression level. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s709i/AtGenExpress_ATTED_all.html#work_information'>AtGenExpress_ATTED_all</a> </td> <td> Lists for the AtGenExpress and ATTED-II mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> </table>
AtGenExpress_ATTED_all
[
motifexpress
]
Rank Lists of AtGenExpress median gene expression + PLACE promoter motif
Contributor:Koro_Nishikata
Update:Apr 29, 2013
278 Downloads, 8 Applications
Lists for the AtGenExpress and PLACE mashup data table. For each experiment, all genes ranked by absolute level of median expression. <br><br> <strong>References</strong> (for PLACE)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/9847208">http://www.ncbi.nlm.nih.gov/pubmed/9847208</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s748i/AtGenExpress_PLACE_all.html#work_information'>AtGenExpress_PLACE_all</a> </td> <td> Lists for the AtGenExpress and PLACE mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> </table>
AtGenExpress_PLACE_all
[
motifexpress
]
Developmental Coexpression (AtGenExpress Developmental gene expression + ATTED-II promoter motif) Triplicate Data
Contributor:Koro_Nishikata
Update:May 1, 2013
1430 Downloads, 7 Applications
Full triplicate expression dataset of AtGenExpress plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). MotifExpress tool allows the plloting of all triplicate data points during the design process, so the user has some idea of the experimental variation in the measurements. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Flowering.html#work_information'>AtGenExpress_ATTED_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Fruit_Seeds.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Leaf.html#work_information'>AtGenExpress_ATTED_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Root.html#work_information'>AtGenExpress_ATTED_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Seedling.html#work_information'>AtGenExpress_ATTED_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Stem.html#work_information'>AtGenExpress_ATTED_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s781i/AtGenExpress_ATTED_Whole_Plant.html#work_information'>AtGenExpress_ATTED_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> </table> </td> </tr> </table>
AtGenExpress_ATTED_Flowering
AtGenExpress_ATTED_Fruit_Seeds
AtGenExpress_ATTED_Leaf
AtGenExpress_ATTED_Root
AtGenExpress_ATTED_Seedling
AtGenExpress_ATTED_Stem
AtGenExpress_ATTED_Whole_Plant
GenoCon2 Challenge A - Developmental Coexpression (AtGenExpress + ATTED-II promoter motif)
Contributor:GenoCon
Update:Sep 19, 2012
3325 Downloads, 7 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant tissues, with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a>
Flowering_GeneExp_v3_median
Fruit_Seeds_GeneExp_v3_median
Heptamer_elements
Leaf_GeneExp_v3_median
Root_GeneExp_v3_median
Seedling_GeneExp_v3_median
Stem_GeneExp_v3_median
Whole_Plant_GeneExp_v3_median
AtGenExpress gene expression + PLACE promoter motif Triplicate Data
Contributor:Koro_Nishikata
Update:May 1, 2013
1496 Downloads, 7 Applications
Full triplicate expression dataset of AtGenExpress plant developmental tissues, combined with PLACE (Plant Cis-acting Regulatory DNA Elements) motif database. MotifExpress tool allows the plloting of all triplicate data points during the design process, so the user has some idea of the experimental variation in the measurements. <br><br> <strong>References</strong> (for PLACE)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/9847208">http://www.ncbi.nlm.nih.gov/pubmed/9847208</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Flowering.html#work_information'>AtGenExpress_PLACE_Flowering</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Fruit_Seeds.html#work_information'>AtGenExpress_PLACE_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Leaf.html#work_information'>AtGenExpress_PLACE_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Root.html#work_information'>AtGenExpress_PLACE_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Seedling.html#work_information'>AtGenExpress_PLACE_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Stem.html#work_information'>AtGenExpress_PLACE_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/AtGenExpress_PLACE_Whole_Plant.html#work_information'>AtGenExpress_PLACE_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <!-- <tr> <td> <a href='http://linkdata.org/work/rdf1s783i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> --> </table> </td> </tr> </table>
AtGenExpress_PLACE_Flowering
AtGenExpress_PLACE_Fruit_Seeds
AtGenExpress_PLACE_Leaf
AtGenExpress_PLACE_Root
AtGenExpress_PLACE_Seedling
AtGenExpress_PLACE_Stem
AtGenExpress_PLACE_Whole_Plant
Developmental Genomic (AtGenExpress + PPDB promoter motif) median
Contributor:Koro_Nishikata
Update:May 10, 2013
1787 Downloads, 16 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). For each motif, we calculated the position relative to the TSS as determined experimentally (PPDB). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Flowering_median.html#work_information'>AtGenExpress_PPDB_Flowering_median</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Fruit_Seeds_median.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Leaf_median.html#work_information'>AtGenExpress_PPDB_Leaf_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Root_median.html#work_information'>AtGenExpress_PPDB_Root_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Seedling_median.html#work_information'>AtGenExpress_PPDB_Seedling_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Stem_median.html#work_information'>AtGenExpress_PPDB_Stem_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/AtGenExpress_PPDB_Whole_Plant_median.html#work_information'>AtGenExpress_PPDB_Whole_Plant_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s705i/Octamer_elements.html#work_information'>Octamer_elements</a> </td> <td> A list of the 8mer sequence motifs from PPDB. This table lists each 8mer along with the appropriate median position from the TSS, calculated from all 8mers. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
AtGenExpress_PPDB_Flowering_median
AtGenExpress_PPDB_Fruit_Seeds_median
AtGenExpress_PPDB_Leaf_median
AtGenExpress_PPDB_Root_median
AtGenExpress_PPDB_Seedling_median
AtGenExpress_PPDB_Stem_median
AtGenExpress_PPDB_Whole_Plant_median
Octamer_elements
PromoterCAD_links
Contributor:GenoCon
Update:May 16, 2013
206 Downloads, 16 Applications
This will tell the PromoteCAD Application the external link URL of each gene locus.
External_Links
[
external_links
]
AtGenExpress median gene expression + PLACE promoter motif
Contributor:Koro_Nishikata
Update:May 1, 2013
1574 Downloads, 8 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with PLACE (Plant Cis-acting Regulatory DNA Elements) motif database. We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). For each motif, we calculated the position relative to the TSS as determined experimentally. Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for PLACE)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/9847208">http://www.ncbi.nlm.nih.gov/pubmed/9847208</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Flowering_median.html#work_information'>AtGenExpress_PLACE_Flowering_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Fruit_Seeds_median.html#work_information'>AtGenExpress_PLACE_Fruit_Seeds_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Leaf_median.html#work_information'>AtGenExpress_PLACE_Leaf_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Root_median.html#work_information'>AtGenExpress_PLACE_Root_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Seedling_median.html#work_information'>AtGenExpress_PLACE_Seedling_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Stem_median.html#work_information'>AtGenExpress_PLACE_Stem_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/AtGenExpress_PLACE_Whole_Plant_median.html#work_information'>AtGenExpress_PLACE_Whole_Plant_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <!-- <tr> <td> <a href='http://linkdata.org/work/rdf1s740i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> --> </table> </td> </tr> </table>
AtGenExpress_PLACE_Flowering_median
AtGenExpress_PLACE_Fruit_Seeds_median
AtGenExpress_PLACE_Leaf_median
AtGenExpress_PLACE_Root_median
AtGenExpress_PLACE_Seedling_median
AtGenExpress_PLACE_Stem_median
AtGenExpress_PLACE_Whole_Plant_median
PromoterCAD Data Tables
Contributor:GenoCon
Update:May 16, 2013
255 Downloads, 6 Applications
This will allow the PromoteCAD Application to find the appropriate tools, the input data and the gene rank list.
PromoterCAD_Data_Tables
[
menu
]
Developmental Genomic (AtGenExpress Developmental gene expression + PPDB promoter motif) Triplicate Data
Contributor:Koro_Nishikata
Update:May 10, 2013
1244 Downloads, 7 Applications
Full triplicate expression dataset of AtGenExpress plant developmental tissues, combined with LDSS sequence analysis of regulatory (8mer) motif calculations (PPDB). MotifExpress tool allows the plloting of all triplicate data points during the design process, so the user has some idea of the experimental variation in the measurements. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a> <br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Flowering.html#work_information'>AtGenExpress_PPDB_Flowering</a> </td> <td> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Fruit_Seeds.html#work_information'>AtGenExpress_PPDB_Fruit_Seeds</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Leaf.html#work_information'>AtGenExpress_PPDB_Leaf</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Root.html#work_information'>AtGenExpress_PPDB_Root</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Seedling.html#work_information'>AtGenExpress_PPDB_Seedling</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Stem.html#work_information'>AtGenExpress_PPDB_Stem</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s782i/AtGenExpress_PPDB_Whole_Plant.html#work_information'>AtGenExpress_PPDB_Whole_Plant</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
AtGenExpress_PPDB_Flowering
AtGenExpress_PPDB_Fruit_Seeds
AtGenExpress_PPDB_Leaf
AtGenExpress_PPDB_Root
AtGenExpress_PPDB_Seedling
AtGenExpress_PPDB_Stem
AtGenExpress_PPDB_Whole_Plant
Rank Lists of AtGenExpress PPDB
Contributor:Koro_Nishikata
Update:May 10, 2013
245 Downloads, 16 Applications
Lists for the expression of AtGenExpress and PPDB mashup data table. For each experiment, all genes ranked by expression level. <br><br> <strong>References</strong> (for PPDB):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17947329">http://www.ncbi.nlm.nih.gov/pubmed/17947329</a><br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17346352">http://www.ncbi.nlm.nih.gov/pubmed/17346352</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s712i/AtGenExpress_PPDB_all.html#work_information'>AtGenExpress_PPDB_all</a> </td> <td> Lists for the AtGenExpress and PPDB (Plant Promoter Database) mashup data table. For each experiment, the all genes ranked by expression level. </td> </tr> </table> <br> <br> <b> <a name="license" style="color:#666666"> License </a> </b> <br> <p> We would like to thank Dr. Yoshiharu Yamamoto for supplying the data of PPDB (Plant Promoter Database) for <a href="http://promotercad.org">PromoterCAD</a> & <a href="http://genocon.org">GenoCon2</a> competition. License of this work's data is according to the intentions of the PPDB original data source.</a> <br> <a href="http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi">http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/license.cgi</a> </p>
AtGenExpress_PPDB_all
[
motifexpress
]
Developmental Coexpression (AtGenExpress gene expression + ATTED-II promoter motif) median
Contributor:Koro_Nishikata
Update:May 1, 2013
1900 Downloads, 16 Applications
Developmental Microarray Expression Data (AtGenExpress) of plant developmental tissues, combined with CEG coexpression analysis regulatory (7mer) motif calculations (ATTED-II). We took the median of triplicate measurements from AtGenExpress, then sorted the developmental series into plant organs (Flower, Leaf, Root, Stem, Fruit & Seeds), with one category for seedlings (8 days old or less) and another for whole plants (older than 8 days). Gene Loci without expression data or motif data were removed from this database. <br><br> <strong>References</strong> (for ATTED-II):<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/17130150">http://www.ncbi.nlm.nih.gov/pubmed/17130150</a><br> <strong>References</strong> (for AtGenExpress)<br> <a href="http://www.ncbi.nlm.nih.gov/pubmed/15806101">http://www.ncbi.nlm.nih.gov/pubmed/15806101</a> <br> <br> <br> <b> Descriptions for each data table: </b> <table> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Flowering_median.html#work_information'>AtGenExpress_ATTED_Flowering_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with flowering tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Fruit_Seeds_median.html#work_information'>AtGenExpress_ATTED_Fruit_Seeds_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with fruit and seed tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Leaf_median.html#work_information'>AtGenExpress_ATTED_Leaf_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with leaf tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Root_median.html#work_information'>AtGenExpress_ATTED_Root_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with root tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Seedling_median.html#work_information'>AtGenExpress_ATTED_Seedling_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with seedling tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Stem_median.html#work_information'>AtGenExpress_ATTED_Stem_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with stem tissues. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/AtGenExpress_ATTED_Whole_Plant_median.html#work_information'>AtGenExpress_ATTED_Whole_Plant_median</a> </td> <td> <br> This collection of Gene Expression Properties are associated with whole plant body parts. </td> </tr> <tr> <td> <a href='http://linkdata.org/work/rdf1s584i/Heptamer_elements.html#work_information'>Heptamer_elements</a> </td> <td>A list of the 7mer sequence motifs from ATTED-II. This table lists each 7mer along with the calculated CEG value and the position from the TSS of the maximum CEG value.</td> </tr> </table> . </td> </tr> </table>
AtGenExpress_ATTED_Flowering_median
AtGenExpress_ATTED_Fruit_Seeds_median
AtGenExpress_ATTED_Leaf_median
AtGenExpress_ATTED_Root_median
AtGenExpress_ATTED_Seedling_median
AtGenExpress_ATTED_Stem_median
AtGenExpress_ATTED_Whole_Plant_median
Heptamer_elements
Add LinkData work(LinkData)
Link http://app.linkdata.org/run/app1s339i?tab=readme
Initial content
jquery-1.7.1.min.js
jquery-ui-1.8.18.min.js
http://code.highcharts.com/highcharts.js
http://code.highcharts.com/modules/exporting.js
http://code.highcharts.com/highcharts-more.js
Work
Add
Clear
insert work id or work name.